7 resultados para Micro-region of Bananal

em DigitalCommons@The Texas Medical Center


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Not enough research efforts on depression have been carried out up to now in Latin America. The knowledge that has resulted from research activities in the United States or Europe offers limited generalizability to other regions of the world, including Latin America. In the Andean highlands of Ecuador, we found very high rates of moderate and severe depressive symptoms, a finding that must be interpreted within its cultural context. Somatic manifestations of depression predominated over cognitive manifestations, and higher education level was protective against depression. These findings call for an appreciation of culturally-specific manifestations of depression and the social factors that influence them. These factors must be further studied in order to give them the deserved priority, allocate resources appropriately, and formulate innovative psychosocial interventions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Involvement of E. coli 23S ribosomal RNA (rRNA) in decoding of termination codons was first indicated by the characterization of a 23S rRNA mutant that causes UGA-specific nonsense suppression. The work described here was begun to test the hypothesis that more 23S rRNA suppressors of specific nonsense mutations can be isolated and that they would occur non-randomly in the rRNA genes and be clustered in specific, functionally significant regions of rRNA.^ Approximately 2 kilobases of the gene for 23S rRNA were subjected to PCR random mutagenesis and the amplified products screened for suppression of nonsense mutations in trpA. All of the suppressor mutations obtained were located in a thirty-nucleotide part of the GTPase center, a conserved rRNA sequence and structure, and they and others made in that region by site-directed mutagenesis were shown to be UGA-specific in their suppression of termination codon mutations. These results proved the initial hypothesis and demonstrated that a group of nucleotides in this region are involved in decoding of the UGA termination codon. Further, it was shown that limitation of cellular availability or synthesis of L11, a ribosomal protein that binds to the GTPase center rRNA, resulted in suppression of termination codon mutations, suggesting the direct involvement of L11 in termination in vivo.^ Finally, in vivo analysis of certain site-specific mutations made in the GTPase center RNA demonstrated that (a) the G$\cdot$A base pair closing the hexanucleotide hairpin loop was not essential for normal termination, (b) the "U-turn" structure in the 1093 to 1098 hexaloop is critical for normal termination, (c) nucleotides A1095 and A1067, necessary for the binding to ribosomes of thiostrepton, an antibiotic that inhibits polypeptide release factor binding to ribosomes in vitro, are also necessary for normal peptide chain termination in vivo, and (d) involvement of this region of rRNA in termination is determined by some unique subset structure that includes particular nucleotides rather than merely by a general structural feature of the GTPase center.^ This work advances the understanding of peptide chain termination by demonstrating that the GTPase region of 23S rRNA participates in recognition of termination codons, through an associated ribosomal protein and specific conserved nucleotides and structural motifs in its RNA. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Since the tragic events of September, 11 2001 the United States bioterrorism and disaster preparedness has made significant progress; yet, numerous research studies of nationwide hospital emergency response have found alarming shortcomings in surge capacity and training level of health care personnel in responding to bioterrorism incidents. The primary goals of this research were to assess hospital preparedness towards the threat of bioterrorist agents in the Southwest Region of the United States and provide recommendations for its improvement. Since little formal research has been published on the hospital preparedness of Oklahoma, Arizona, Texas and New Mexico, this research study specifically focused on the measurable factors affecting the respective states' resources and level of preparedness, such as funding, surge capacity and preparedness certification status.^ Over 300 citations of peer-reviewed articles and 17 Web sites were reviewed, of which 57 reports met inclusion criteria. The results of the systematic review highlighted key gaps in the existing literature and the key targets for future research, as well as identified strengths and weaknesses of the hospital preparedness in the Southwest states compared to the national average. ^ Based on the conducted research, currently, the Southwest states hospital systems are unable fully meet presidential preparedness mandates for emergency and disaster care: the staffed beds to 1,000 population value fluctuated around 1,5 across the states; funding for the hospital preparedness lags behind hospital costs by millions of dollars; and public health-hospital partnership in bioterrorism preparedness is quite weak as evident in lack of joint exercises and training. However, significant steps towards it are being made, including on-going hospital preparedness certification by the Joint Commission of Health Organization. Variations in preparedness levels among states signify that geographic location might determine a hospital level of bioterrorism preparedness as well, tending to favor bigger states such as Texas.^ Suggested recommendations on improvement of the hospital bioterrorism preparedness are consistent with the existing literature and include establishment and maintenance of solid partnerships between hospitals and public health agencies, conduction of joint exercises and drills for the health care personnel and key partners, improved state and federal funding specific to bioterrorism preparedness objectives, as well as on-going training of the clinical personnel on recognition of the bioterrorism agents.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

It is the aim of this paper to examine iron supplementation programs which receive funding from United States Agency for International Development (USAID) but approach combating iron deficiency anemia in two vastly different ways. A brief literature review and background information on iron deficiencies and the differences between supplementation programs and micronutrient fortification were reviewed. Two non-governmental organizations (NGO's) were examined for this paper: the Food and Nutrition Technical Assistance II (FANTA) and the MicroNutrient Initiative. The FANTA program included an educational component to their supplementation program while the MicroNutrient Initiative solely used supplementation of micronutrients to their population. Methods used were cost-benefit analysis and cost-effectiveness analysis to determine the overall effectiveness of each program in reducing iron deficiency anemia in each population, if the added costs of the incentives in the FANTA program changed the cost-effectiveness of the program compared to the MicroNutrient Initiative program and to determine which program imparted the greatest benefit to each population by reducing the disease burden in Disability Adjusted Life Years (DALY). Results showed that the unit cost of the FANTA program per person was higher than the MicroNutrient Initiative program due to the educational component. The FANTA program reduced iron deficiency anemia less overall but cost less for each percentage point of anemia decreased in their respective populations. The MicroNutrient Initiative program had a better benefit cost ratio for the populations it served. The MicroNutrient Initiative's large scale program imparted many advantages by reducing unit cost per person and decreasing iron deficiency anemia. The FANTA program was more effective at decreasing iron deficiency anemia with less money: $5,660 per 1% decrease in iron deficiency anemia versus $18,450 per 1% decrease in iron deficiency anemia for the MicroNutrient Initiative program. ^ In conclusion, economic analysis cannot measure all of the benefits associated with programs that contain an educational component or large scale supplementation. More information needs to be gathered by NGOs and reported to USAID, such as detailed prevalence rates of iron deficiency anemia among the populations served. Further research is needed to determine the effects an educational supplementation program has on compliance rates of participants and motivation to participate in supplementation programs whose aim is to decrease iron deficiency anemia in a targeted population.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The commercial sexual exploitation of children (CSEC) has emerged as one of the world’s most heinous crimes. The problem affects millions of children worldwide and no country or community is fully immune from its effects. This paper reports first generation research of the relationship that exists between CSEC and the phenomenon of missing children living in and around the coastal regions of the state of Sao Paulo, Brazil, the country’s richest State. Data are reported from interviews and case records of 64 children and adolescents, who were receiving care through a major youth serving non-governmental organization (NGO) located in the coastal city of Sao Vicente. Also, data about missing children and adolescents were collected from Police Reports – a total of 858 Police Reports. In Brazil, prostitution is not a crime itself, however, the exploitation of prostitution is a crime. Therefore, the police have no information about children or adolescents in this situation, they only have information about the clients and exploiters. Thus, this investigation sought to accomplish two objectives: 1) to establish the relationship between missing and sexual exploited children; and 2) to sensitize police and child-serving authorities in both the governmental and nongovernmental sectors to the nature, extent, and seriousness of many unrecognized cases of CSEC and missing children that come to their attention. The observed results indicated that the missing children police report are significantly underestimated. They do not represent the number of children that run away and/or are involved in commercial sexual exploitation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tumor Suppressor Candidate 2 (TUSC2) is a novel tumor suppressor gene located in the human chromosome 3p21.3 region. TUSC2 mRNA transcripts could be detected on Northern blots in both normal lung and some lung cancer cell lines, but no endogenous TUSC2 protein could be detected in a majority of lung cancer cell lines. Mechanisms regulating TUSC2 protein expression and its inactivation in primary lung cancer cells are largely unknown. We investigated the role of the 5’- and 3’-untranslated regions (UTRs) of the TUSC2 gene in the regulation of TUSC2 protein expression. We found that two small upstream open-reading frames (uORFs) in the 5’UTR of TUSC2 could markedly inhibit the translational initiation of TUSC2 protein by interfering with the “scanning” of the ribosome initiation complexes. Site-specific stem-loop array reverse transcription-polymerase chain reaction (SLA-RT-PCR) verified several micoRNAs (miRNAs) targeted at 3’UTR and directed TUSC2 cleavage and degradation. In addition, we used the established let-7-targeted high mobility group A2 (Hmga2) mRNA as a model system to study the mechanism of regulation of target mRNA by miRNAs in mammalian cells under physiological conditions. There have been no evidence of direct link between mRNA downregulation and mRNA cleavages mediated by miRNAs. Here we showed that the endonucleolytic cleavages on mRNAs were initiated by mammalian miRNA in seed pairing style. Let-7 directed cleavage activities among the eight predicted potential target sites have varied efficiency, which are influenced by the positional and the structural contexts in the UTR. The 5’ cleaved RNA fragments were mostly oligouridylated at their 3’-termini and accumulated for delayed 5’–3’ degradation. RNA fragment oligouridylation played important roles in marking RNA fragments for delayed bulk degradation and in converting RNA degradation mode from 3’–5’ to 5’–3’ with cooperative efforts from both endonucleolytic and non-catalytic miRNA-induced silencing complex (miRISC). Our findings point to a mammalian miRNA-mediated mechanism for the regulation of mRNA that miRNA can decrease target mRNA through target mRNA cleavage and uridine addition

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^