A process evaluation of the childhood lead poisoning prevention program in Houston, Texas, 1992--1995

A process evaluation of the Houston Childhood Lead Poisoning Prevention Program, 1992-1995, was conducted. The Program's goal is to reduce lead poisoning prevalence. The study proposed to determine to what extent the Program was implemented as planned by measuring how well Program services were actually: (1) received by the intended target population; (2) delivered to children with elevated blood lead levels; (3) delivered in compliance with the Centers for Disease Control and Prevention and Program guidelines and timetables; and (4) able to reduce lead poisoning prevalence among those rescreened. Utilizing a program monitoring design, the Program's pre-collected computer records were reviewed. The study sample consisted of 820 children whose blood lead levels were above 15 micrograms per deciLiter, representing approximately 2.9% of the 28,406 screened over this period. Three blood lead levels from each participant were examined: the initial elevated result; the confirmatory result; and the next rescreen result, after the elevated confirmatory level. Results showed that the Program screened approximately 18% (28,406 of 161,569) of Houston's children under age 6 years for lead poisoning. Based on Chi-square tests of significance, results also showed that lead-poisoned participants were more likely to be younger than 3 years, male and Hispanic, compared to those not lead poisoned. The age, gender and ethnic differences observed were statistically significant (p =.01, p =.00, p =.00). Four of the six Program services: medical evaluations, rescreening, environmental inspections and confirmation, had satisfactory delivery completion rates of 71%-98%. Delivery timetable compliance rates for three of the six services examined: outreach contacts, home visits and environmental inspections were below 32%. However, dangerously elevated blood lead levels fell and lead poisoning prevalence dropped from 3.3% at initial screening to 1.2% among those rescreened, after intervention. From a public health perspective, reductions in lead poisoning prevalence are very meaningful. Based on these findings, the following are recommendations for future research: (1) integrate Program database files by utilizing a computer database management program; (2) target services at Hispanic male children under age 3 years living in the highest risk neighborhoods; (3) increase resources to: improve tracking and documentation of service delivery and provide more non-medical case management and environmental services; and (4) share the evaluation methodology/findings with the Centers for Disease Control and Prevention administrators; the implications may be relevant to other program managers conducting such assessments. ^

A study of the biology of perlecan

Extracellular matrix (ECM) is a component of a variety of organisms that provides both structural support and influence upon the cells it surrounds. The importance of the ECM is becoming more apparent as matrix defects are linked to human disease. In this study, the large, extracellular matrix heparan sulfate proteoglycan, perlecan (Pln) is examined in two systems. First, the role of Pln in the interaction between a blastocyst and uterine epithelial cells is investigated. In mice, blastocyst attachment and implantation occurs at approximately d 4.5 post coitus. In addition, a delayed implantation model has been used to distinguish between the response of the blastocyst to that of hatching and of becoming attachment competent. ^ The second series of experiments described in this study focuses on the process of chondrogenesis in mice. Pln, commonly expressed with other basement membrane (BM) proteins, was found to be expressed in cartilaginous tissue without other BM proteins. This unusual expression pattern led to further study and the development of an in vitro chondrogenesis assay using the mouse embryonic fibroblast cell line, C3H/10T1/2. When cultured on Pln in vitro, these cells form aggregates and express the cartilage proteins, collagen type II and aggrecan. In examining the participation of the heparan sulfate (HS) chains in this process, the proteoglycan was enzymatically digested to remove the HS chains before the initiation of 10T1/2 cell culture. After digestion, the ability of Pln to stimulate aggregate formation was greatly diminished. Thus, the HS chains participate in the cell induction process. To determine which domain of Pln might be responsible for this activity, recombinant fragments of Pin were used in the cell culture assay. Of all recombinant protein fragments tested, only the domain including the HS chains, domain 1, was able to initiate the morphological change exhibited by the 10T1/2 cells. Similar to native Pln, when HS chains were removed from domain I, chondrogenic activity was abolished. A variant of domain I carrying both HS and chondroitin sulfate (CS) chains retained activity when only HS chains were removed. When both HS and CS chains were removed, then activity was lost. ^ The ability to rapidly stimulate differentiation of 10T1/2 cells in vitro may lead to better control of chondrogenesis in vitro and in vivo, providing better understanding and manipulation of the chondrogenic process. This greater understanding may have benefits for study of cartilage and bone diseases and subsequent treatment options. (Abstract shortened by UMI.)^

Utilization behavior of the elderly in an HMO: A causal analysis

Planning and providing health care services for the elderly represents a major challenge to the health care system. One part of that challenge is the identification of those factors which determine the utilization of services by this population. The purpose of this study is to explain the use of health care services by elderly subscribers in a prepaid group health plan, using the theoretical framework developed by Andersen and Aday. The impact of the predisposing, enabling and need factors on utilization was modelled through a structural equation approach using LISREL. The data were derived from Kaiser-Permanente's Medicare Prospective Payment Project, August 1980-December 1982. Need factors, in general, were the most significant determinants of utilization, with the predisposing and enabling factors found to be secondary but necessary links in the causal chain. The model was fitted to the data from the youngest age group (65-74 years) and then evaluated for goodness of fit in the two older groups (75-84 and 85+ years). Implications of the study's findings and suggestions for further modelling the utilization behavior of the elderly are discussed. ^

The Hospital Study of the City of Houston and Harris County

In 1941 the Texas Legislature appropriated $500,000 to the Board of Regents of the University of Texas to establish a cancer research hospital. The M. D. Anderson Foundation offered to match the appropriation with a grant of an equal sum and to provide a permanent site in Houston. In August, 1942 the Board of Regent of the University and the Trustees of the Foundation signed an agreement to embark on this project. This institution was to be the first one in the medical center, which was incorporated in October, 1945. The Board of Trustees of the Texas Medical Center commissioned a hospital survey to: - Define the needed hospital facilities in the area - Outline an integrated program to meet these needs - Define the facilities to be constructed - Prepare general recommendations for efficient progress The Hospital Study included information about population, hospitals, and other health care and education facilities in Houston and Harris County at that time. It included projected health care needs for future populations, education needs, and facility needs. It also included detailed information on needs for chronic illnesses, a school of public health, and nursing education. This study provides valuable information about the general population and the state of medicine in Houston and Harris County in the 1940s. It gives a unique perspective on the anticipated future as civic leaders looked forward in building the city and region. This document is critical to an understanding of the Texas Medical Center, Houston and medicine as they are today. SECTIONS INCLUDE: Abstract The Abstract was a summary of the 400 page document including general information about the survey area, community medical assets, and current and projected medical needs which the Texas Medical Center should meet. The 123 recommendations were both general (e.g., 12. “That in future planning, the present auxiliary department of the larger hospitals be considered inadequate to carry an added teaching research program of any sizable scope.”) and specific (e.g., 22. That 14.3% of the total acute bed requirement be allotted for obstetric care, reflecting a bed requirement of 522 by 1950, increasing to 1,173 by 1970.”) Section I: Survey Area This section basically addressed the first objective of the survey: “define the needed hospital facilities in the area.” Based on the admission statistics of hospitals, Harris County was included in the survey, with the recognition that growth from out-lying regional areas could occur. Population characteristics and vital statistics were included, with future trends discussed. Each of the hospitals in the area and government and private health organizations, such as the City-County Welfare Board, were documented. Statistics on the facilities use and capacity were given. Eighteen recommendations and observations on the survey area were given. Section II: Community Program This section basically addressed the second objective of the survey: “outline an integrated program to meet these needs.” The information from the Survey Area section formed the basis of the plans for development of the Texas Medical Center. In this section, specific needs, such as what medical specialties were needed, the location and general organization of a medical center, and the academic aspects were outlined. Seventy-four recommendations for these plans were provided. Section III: The Texas Medical Center The third and fourth objectives are addressed. The specific facilities were listed and recommendations were made. Section IV: Special Studies: Chronic Illness The five leading causes of death (heart disease, cancer, “apoplexy”, nephritis, and tuberculosis) were identified and statistics for morbidity and mortality provided. Diagnostic, prevention and care needs were discussed. Recommendations on facilities and other solutions were made. Section IV: Special Studies: School of Public Health An overview of the state of schools of public health in the US was provided. Information on the direction and need of this special school was also provided. Recommendations on development and organization of the proposed school were made. Section IV: Special Studies: Needs and Education Facilities for Nurses Nursing education was connected with hospitals, but the changes to academic nursing programs were discussed. The needs for well-trained nurses in an expanded medical environment were anticipated to result in significant increased demands of these professionals. An overview of the current situation in the survey area and recommendations were provided. Appendix A Maps, tables and charts provide background and statistical information for the previous sections. Appendix B Detailed census data for specific areas of the survey area in the report were included. Sketches of each of the fifteen hospitals and five other health institutions showed historical information, accreditations, staff, available facilities (beds, x-ray, etc.), academic capabilities and financial information.

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^