Studies of subcellular localization and complex formation of the Agrobacterium tumefaciens transport ATPase VirB11

The VirB11 ATPase is an essential component of an Agrobacterium tumefaciens type IV bacterial secretion system that transfers oncogenic nucleoprotein complexes to susceptible plant cells. This dissertation investigates the subcellular localization and homo-oligomeric state of the VirB11 ATPase in order to provide insights about the assembly of the protein as a subunit of this membrane-associated transfer system. Subcellular fractionation studies and quantitative immunoblot analysis demonstrated that $\sim$30% of VirB11 partitioned as soluble protein and $\sim$70% was tightly associated with the bacterial cytoplasmic membrane. No differences were detected in VirB11 subcellular localization and membrane association in the presence or absence of other transport system components. Mutations in virB11 affecting protein function were mapped near the amino terminus, just upstream of a region encoding a Walker 'A' nucleotide-binding site, and within the Walker 'A' motif partitioned almost exclusively with the cytoplasmic membrane, suggesting that an activity associated with nucleotide binding could modulate the affinity of VirB11 for the cytoplasmic membrane. Merodiploid analysis of VirB11 mutant and truncation derivatives provided strong evidence that VirB11 functions as a homo- or heteromultimer and that the C-terminal half of VirB11 contains a protein interaction domain. A combination of biochemical and molecular genetic approaches suggested that VirB11 and the green fluorescence protein (GFP) formed a mixed multimer as demonstrated by immunoprecipitation experiments with anti-GFP antibodies. Second, a hybrid protein composed of VirB11 fused to the N-terminal DNA-binding domain of bacteriophage $\lambda$ cI repressor conferred immunity to $\lambda$ superinfection, demonstrating that VirB11 self-association promotes dimerization of the chimeric repressor. A conserved Walker 'A' motif, though required for VirB11 function in T-complex export, was not necessary for VirB11 self-association. Sequences in both the N- and the C-terminal halves of the protein were found to contribute to self-association of the full length protein. Chemical cross-linking experiments with His$\sb6$ tagged VirB11 suggested that VirB11 probably assembles into a higher order homo-oligomeric complex. ^

A molecular analysis of the conditional defect in MuSVts 110 viral RNA splicing

Cells infected with MuSVts110 express a viral RNA which contains an inherent conditional defect in RNA splicing. It has been shown previously that splicing of the MuSVts110 primary transcript is essential to morphological transformation of 6m2 cells in vitro. A growth temperature of 33$\sp\circ$C is permissive for viral RNA splicing,and, consequently, 6m2 cells appear morphologically transformed at this temperature. However, 6m2 cells appear phenotypically normal when incubated at 39$\sp\circ$C, the non-permissive temperature for viral RNA splicing.^ After a shift from 39$\sp\circ$C to 33$\sp\circ$C, the coordinate splicing of previously synthesized and newly transcribed MuSVts110 RNA was achieved. By S1 nuclease analysis of total RNA isolated at various times, 5$\sp\prime$ splice site cleavage of the MuSVts110 transcript appeared to occur 60 minutes after the shift to 33$\sp\circ$C, and 30 minutes prior to detectable exon ligation. In addition, consistent with the permissive temperatures and the kinetic timeframe of viral RNA splicing after a shift to 33$\sp\circ$C, four temperature sensitive blockades to primer extension were identified 26-75 bases upstream of the 3$\sp\prime$ splice site. These blockades likely reflect four branchpoint sequences utilized in the formation of MuSVts110 lariat splicing-intermediates.^ The 54-5A4 cell line is a spontaneous revertant of 6m2 cells and appears transformed at all growth temperatures. Primer extension sequence analysis has shown that a five base deletion occurred at the 3$\sp\prime$ splice site in MuSVts110 RNA allowing the expression of a viral transforming protein in 54-5A4 in the absence of RNA splicing, whereas in the parental 6m2 cell line, a splicing event is necessary to generate a similar transforming protein. As a consequence of this deletion, splicing cannot occur and the formation of the four MuSVts110 branched-intermediates were not observed at any temperature in 54-5A4 cells. However, 5$\sp\prime$ splice site cleavage was still detected at 33$\sp\circ$C.^ Finally, we have investigated the role of the 1488 bp deletion which occurred in the generation of MuSVts110 in the activation of temperature sensitive viral RNA splicing. This deletion appears solely responsible for splice site activation. Whether intron size is the crucial factor in MuSVts110 RNA splicing or whether inhibitory sequences were removed by the deletion is currently unknown. (Abstract shortened with permission of author.) ^

Identifying the roles of the Escherichia coli FtsZ-associated proteins by minimizing the requirements for division

Formation of the FtsZ ring (Z ring) in Escherichia coli is the first step in assembly of the divisome, a molecular machine composed of 14 known proteins which are all required for cell division. Although the biochemical functions of most divisome proteins are unknown, several of these have overlapping roles in ensuring that the Z ring assembles at the cytoplasmic membrane and is active. ^ We identified a single amino acid change in FtsA, R286W, renamed FtsA*, that completely bypasses the requirement for ZipA in cell division. This and other data suggest that FtsA* is a hyperactive form of FtsA that can replace the multiple functions normally assumed by ZipA, which include stabilization of Z rings, recruitment of downstream cell division proteins, and anchoring the Z ring to the membrane. This is the first example of complete functional replacement of an essential prokaryotic cell division protein by another. ^ Cells expressing ftsA* with a complete deletion of ftsK are viable and divide, although many of these ftsK null cells formed multiseptate chains, suggesting a role in cell separation for FtsK. In addition, strains expressing extra ftsAZ, ftsQ, ftsB, zipA or ftsN, were also able to survive and divide in the absence of ftsK. The cytoplasmic and transmembrane domains of FtsQ were sufficient to allow viability and septum formation to ftsK deleted strains. These findings suggest that FtsK is normally involved in stabilizing the divisome and shares functional overlap with other cell division proteins. ^ As well as permitting the removal of other divisome components, the presence of FtsA* in otherwise wild-type cells accelerated Z-ring assembly, which resulted in a significant decrease in the average length of cells. In support of its role in Z-ring stability, FtsA* suppressed the cell division inhibition caused by overexpressing FtsZ. FtsA* did not affect FtsZ turnover within the Z ring as measured by fluorescence recovery after photobleaching. Turnover of FtsA* in the ring was somewhat faster than wild-type FtsA. Yeast two-hybrid data suggest that FtsA* has an increased affinity for FtsZ relative to wild-type FtsA. These results indicate that FtsA* interacts with FtsZ more strongly, and its enhancement of Z ring assembly may explain why FtsA* can permit survival of cells lacking ZipA or FtsK.^

Life and death of the embryonic female reproductive tract

Regardless of genetic sex, amniotes develop two sets of genital ducts, the Wolffian and Müllerian ducts. Normal sexual development requires the differentiation of one duct and the regression of the other. I show that cells in the rostral most region of the coelomic epithelium (CE) are specified to a Müllerian duct fate beginning at Tail Somite Stage 19 (TS19). The Müllerian duct (MD) invaginates from the CE where it extends caudally to and reaches the Wolffian duct (WD) by TS22. Upon contact, the MD elongates to the urogenital sinus separating the WD from the CE and its formation is complete by TS34. During its elongation, the MD is associated with and dependent upon the WD and I have identified the mechanism for MD elongation. Using the Rosa26 reporter to fate map the WD, I show that the WD does not contribute cells to the MD. Using an in vitro recombinant explant culture assay I show that the entire length of the MD is derived from the CE. Furthermore, I analyzed cell proliferation and developed an in vitro assay to show that a small population of cells at the caudal tip proliferates, laying the foundation for the formation of the MD. I also show that during its formation, the MD has a distinctive mesoepithelial character. The MD in males regresses under the influence of Anti-Müllerian Hormone (AMH). Through tissue-specific gene inactivation I have identified that Acvr1 and Bmpr1a and Smad1, Smad5 and Smad8 function redundantly in transducing the AMH signal. In females the MD differentiates into an epithelial tube and eventually the female reproductive tract. However, the exact tissue into which the MD differentiates has not been determined. I therefore generated a MD specific Cre allele that will allow for the fate mapping of the MD in both females males. The MD utilizes a unique form of tubulogenesis during development and to my knowledge is the only tubule that relies upon a signal from and the presence of another distinct epithelial tube for its formation.^

Spectroscopic and functional investigations of the AMPA subtype of ionotropic glutamate receptors

Ion channels play a crucial role in the functioning of different systems of the body because of their ability to bridge the cell membrane and allow ions to pass in and out of the cell. Ionotropic glutamate receptors are one class of these important proteins and have been shown to be critical in propagating synaptic transmission in the central nervous system and in other diverse functions throughout the body. Because of their wide-ranging effects, this family of receptors is an important target for structure-function investigations to understand their mechanism of action. ^ α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are one subtype of glutamate receptors and have been shown to be the primary receptors involved in rapid excitatory signaling in the central nervous system. Agonist binding to the extracellular ligand binding domain of these receptors causes various conformational changes that culminate in formation of the ion channel. Previous structural investigations have provided important information about their mechanism of action, including uncovering a relationship between the degree of cleft closure in the binding domain and activation of the receptor. However, what question remains unanswered is how specific interactions between the agonist and the protein interplay with cleft closure to mediate receptor activation. ^ To investigate this question, I applied a multiscale approach to investigate the effects of agonist binding on various levels. Vibrational spectroscopy was utilized to investigate molecular-level interactions in the binding pocket, and fluorescence resonance energy transfer (FRET) was employed to measure cleft closure in the isolated ligand binding domain. The results of these studies in the isolated binding domain were then correlated to activation of the full receptor. These investigations showed a relationship between the strength of the interaction at the α-amine group of the agonist and extent of receptor activation, where a stronger interaction correlated to a larger activation, which was upheld even when the extent of cleft closure did not correlate to activation. These results show that this interaction at the α-amine group is critical in mediating the allosteric mechanism of activation and provide a bit more insight into how agonist binding is coupled to channel gating in AMPA receptors. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Binding of the HIV-1 gp120 -V3 to cellular glycosphingolipids is necessary for CXCR4 recruitment and infection

Infection by human immunodeficiency virus type 1 (HIV-1) is a multi-step process, and detailed analyses of the various events critical for productive infection are necessary to clearly understanding the infection process and identifying novel targets for therapeutic interventions. Evidence from this study reveals binding of the viral envelope protein to host cell glycosphingolipids (GSLs) as a novel event necessary for the orderly progression of the host cell-entry and productive infection by HIV-1. Data obtained from co-immunoprecipitation analyses and confocal microscopy showed that the ability of viral envelope to interact with the co-receptor CXCR4 and productive infection of HIV-1 were inhibited in cells rendered GSL-deficient, while both these activities were restored after reconstitution of the cells with specific GSLs like GM3. Furthermore, evidence was obtained using peptide-inhibitors of HIV-1 infection to show that binding of a specific region within the V3-loop of the envelope protein gp120 to the host cell GSLs is the trigger necessary for the CD4-bound gp120 to recruit the CXCR4 co-receptor. Infection-inhibitory activity of the V3 peptides was compromised in GSL-deficient cells, but could be restored by reconstitution of GSLs. Based on these findings, a revised model for HIV-1 infection is proposed that accounts for the established interactions between the viral envelope and host cell receptors while enumerating the importance of the new findings that fill the gap in the current knowledge of the sequential events for the HIV-1 entry. According to this model, post-CD4 binding of the HIV-1 envelope surface protein gp120 to host cell GSLs, mediated by the gp120-V3 region, enables formation of the gp120-CD4-GSL-CXCR4 immune-complex and productive infection. The identification of cellular GSLs as an additional class of co-factors necessary for HIV-1 infection is important for enhancing the basic knowledge of the HIV-1 entry that can be exploited for developing novel antiviral therapeutic strategies. ^