Isolation and analysis of regulatory and structural mutations in the {\it recA\/} gene of {\it Escherichia coli}

The recA gene is essential for homologous recombination and for inducible DNA repair in Escherichia coli. The level of recA expression is important for these functions. The growth defect of a lambda phage carrying a recA-lacZ fusion was used to select mutations that reduced recA expression. Nine of these mutations were single base changes in the recA promoter; each reduced both induced and basal (repressed) levels of expression, indicating that only one promoter is used under both circumstances. Deletion analysis of the promoter region and S1 mapping of transcripts confirmed that there is only one promoter responsible for both basal and induced expression. Some of the mutants, however, displayed a ratio of induced to repressed expression that was much lower than wild-type. For one of these mutants (recA1270) LexA binding studies showed that this was not due to a change in the affinity of LexA repressor for the operator site. The extent of binding of RNA polymerase to this mutant promoter, however, was much reduced, and the complexes formed were qualitatively different. Further binding experiments provided some evidence that LexA does not block RNA polymerase binding to the recA promoter, but inhibits a later step in initiation. Behavior of the mutants with altered induction ratios could be explained if LexA binding to the operator actually increases RNA polymerase binding to the promoter in a closed complex compensating for defects in polymerase binding caused by the mutations.^ In a study of mutations in the recA structural gene, site-directed mutagenesis was used to replace cysteine codons at positions 90, 116, and 129 with a number of different codons. In vivo analysis of the replacements showed that none of the cysteines is absolutely essential and that they do not have a direct role as catalysts in ATP hydrolysis. Some amino acid substitutions abolished all RecA functions, while a few resulted in partial or altered function. Amino acids at positions 90 and 129 tended to affect all functions equally, while the amino acid at position 116 appeared to have a particular effect on the protease activity of the protein. ^

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Evolution of cis-regulatory elements in a repetitive sequence adjacent to a sea urchin aboral ectoderm -specific gene

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Computational identification and functional validation of regulatory motifs in cartilage-expressed genes.

Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.

Isolation of Lautropia mirabilis from oral cavities of human immunodeficiency virus-infected children.

Lautropia mirabilis, a pleomorphic, motile, gram-negative coccus, has been isolated from the oral cavities of 32 of 60 (53.3%) children infected with human immunodeficiency virus (HIV) and 3 of 25 (12.0%) HIV-uninfected controls; the association of L. mirabilis isolation with HIV infection is significant (P < 0.001). All children in the study, both HIV-infected children and controls, were born to HIV-infected mothers. The presence of this bacterium was not associated with clinical disease in these children. The HIV-infected children with L. mirabilis did not differ from the HIV-infected children without L. mirabilis in immunological status, clinical status, or systemic medications. The role of HIV infection itself or concomitant factors in the establishment of L. mirabilis in the oral cavity remains to be elucidated.

Getting to Know You: Psychoeducational Groups to Counter Social Isolation of Neglectful Mothers

This research indicates a uniformly positive use of psychoeducational groups to counter social isolation of neglectful mothers. This research was supported by a National Child Welfare Fellowship from the U.S. Children 's Bureau to the author. The author thanks Nancy Dickinson, Sherrill Clark, and the staff of the California Social Work Education Center at the University of California for their oversight and guidance during (his fellowship. The author is also grateful to her fellow fellows for their input and guidance during this research effort. Special thanks to Rose Ben ham, Anna Bowen, Judith Brewington, Caron Byington, Scottye Cash. Dottie Dixon, and Verna Rickard for their support of this project.

Synthesis and properties of heterobifunctional photoaffinity reagents for the identification and isolation of receptors

A method employing isotopically- and photoaffinity-labeled probes and polyclonal and monoclonal antibody to the probes for the identification, isolation and recovery of protein receptors is described. Antibody was raised against N-(3-(p-azido-m-($\sp{125}$I) -iodophenyl)) propionate (AIPP) coupled to and photolyzed to BSA. The antibodies specifically bound AIPP-derivatized proteins. An isolation system was developed utilizing this probe and two antigenically identical reversible analogues. N-(3-((p-azido-m-($\sp{125}$I) -iodo-phenyl)propionyl)amidoethyl-1,3-dithiopropionyl) succinimide (Reversible $\sp{125}$I-AIPPS) reacts with primary amines and N-(((3-p-azido-m-($\sp{125}$I) -iodophenyl)propionyl)amidoethyl)dithiopyridine ($\sp{125}$I-AIPP-PDA) reacts with reduced thiols. The applicability of the system was established by derivatizing known ligands (Transferrin and Interferon-alpha) with one of the probes. The ligand-probe was then allowed to interact with its receptor by incubation with SS5 lymphoma cells and cross-linked by photolysis at 300 nm. The photolyzed ligand/probe/receptor preparation was then recovered with AIPP antibody. Utilization of N-(3-((p-azido-m-($\sp{125}$I) -iodo-phenyl-propionyl)-amidoethyl-1,3-dithiopropionyl) succinimide (Reversible $\sp{125}$I-AIPPS) allowed the components of the photolyzed complex to be separated by treatment with 2-mercaptoethanol in the SDS-PAGE solubilization buffer. Ligand and receptor labeling were then assessed by Coomassie staining and autoradiography. Results of receptor assays suggest that $\sp{125}$I-AIPP was, indeed, transferred to moieties that represent the receptors for both Transferrin and Interferon-alpha. ^

Mechanism of mRNA stability control mediated by AU -rich element: Characterization of cis-elements and trans-factors

Regulation of cytoplasmic deadenylation, the first step in mRNA turnover, has direct impact on the fate of gene expression. AU-rich elements (AREs) found in the 3′ untranslated regions of many labile mRNAs are the most common RNA-destabilizing elements known in mammalian cells. Based on their sequence features and functional properties, AREs can be divided into three classes. Class I or class III ARE directs synchronous deadenylation, whereas class II ARE directs asynchronous deadenylation with the formation of poly(A)-intermediates. Through systematic mutagenesis study, we found that a cluster of five or six copies of AUUUA motifs forming various degrees of reiteration is the key feature dictating the choice between asynchronous versus synchronous deadenylation. A 20–30 nt AU-rich sequence immediately 5 ′ to this cluster of AUUUA motifs can greatly enhance its destabilizing ability and is an integral part of the AREs. These two features are the defining characteristics of class II AREs. ^ To better understand the decay mechanism of AREs, current methods have several limitations. Taking the advantage of tetracycline-regulated promoter, we developed a new transcriptional pulse strategy, Tet-system. By controlling the time and the amount of Tet addition, a pulse of RNA could be generated. Using this new system, we showed that AREs function in both growth- and density-arrested cells. The new strategy offers for the first time an opportunity to investigate control of mRNA deadenylation and decay kinetics in mammalian cells that exhibit physiologically relevant conditions. ^ As a member of heterogeneous nuclear RNA-binding protein, hnRNP D 0/AUF1 displays specific affinities for ARE sequences in vitro . But its in vivo function in ARE-mediated mRNA decay is unclear. AUF1/hnRNP D0 is composed of at least four isoforms derived by alternative RNA splicing. Each isoform exhibits different affinity for ARE sequence in vitro. Here, we examined in vivo effect of AUF1s/hnRNP D0s on degradation of ARE-containing mRNA. Our results showed that all four isoforms exhibit various RNA stabilizing effects in NIH3T3 cells, which are positively correlated with their binding affinities for ARE sequences. Further experiments indicated that AUF1/hnRNP D0 has a general role in modulating the stability of cytoplasmic mRNAs in mammalian cells. ^

Isolation, characterization and transcriptional regulation of {\it Xenopus myod\/}

I have cloned cDNAs corresponding to two distinct genes, Xlmf1 and Xlmf25, which encode skeletal muscle-specific, transcriptional regulatory proteins. These proteins are members of the helix-loop-helix family of DNA binding factors, and are most homologous to MyoD1. These two genes have disparate temporal expression patterns during early embryogenesis; although, both transcripts are present exclusively in skeletal muscle of the adult. Xlmf1 is first detected 7 hours after fertilization, shortly after the midblastula transition. Xlmf25 is detected in maternal stores of mRNA, during early cleavage stages of the embryo and throughout later development. Both Xlmf1 and Xlmf25 transcripts are detected prior to the expression of other, previously characterized, muscle-specific genes. The ability of Xlmf1 and Xlmf25 to convert mouse 10T1/2 fibroblasts to a myogenic phenotype demonstrates their activity as myogenic regulatory factors. Additionally, Xlmf1 and Xlmf25 can directly transactivate a reporter gene linked to the muscle-specific, muscle creatine kinase (MCK) enhancer. The functional properties of Xlmf1 and Xlmf25 proteins were further explored by investigating their interactions with the binding site in the MCK enhancer. Analysis of dissociation rates revealed that Xlmf25-E12 dimers had a two-fold lower avidity for this site than did Xlmf1-E12 dimers. Clones containing genomic sequence of Xlmf1 and Xlmf25 have been isolated. Reporter gene constructs containing a lac-z gene driven by Xlmf1 regulatory sequences were analyzed by embryo injections and transfections into cultured muscle cells. Elements within $-$200 bp of the transcription start site can promote high levels of muscle specific expression. Embryo injections show that 3500 bp of upstream sequence is sufficient to drive somite specific expression. EMSAs and DNAse I footprint analysis has shown the discrete interaction of factors with several cis-elements within 200 bp of the transcription start site. Mutation of several of these elements shows a positive requirement for two CCAAT boxes and two E boxes. It is evident from the work performed with this promoter that Xlmf1 is tightly regulated during muscle cell differentiation. This is not surprising given the fact that its gene product is crucial to the determination of cell fate choices. ^

NFkappaB and STAT binding elements participate in regulation of MUC1 expression in normal and transformed mammary epithelial cells

The MUC1 gene encodes a transmembrane mucin glycoprotein that is overexpressed in several cancers of epithelial origin, including those of breast, pancreas, lung, ovary, and colon. Functions of MUC1 include protection of mucosal epithelium, modulation of cellular adhesion, and signal transduction. Aberrantly increased expression of MUC1 in cancer cells promotes tumor progression through adaptation of these functions. Some regulatory elements participating in MUC1 transcription have been described, but the mechanisms responsible for overexpression are largely unknown. A region of MUC1 5′ flanking sequence containing two conserved potential cytokine response elements, an NFκB site at −589/−580 and a STAT binding element (SBE) at −503/−495, has been implicated in high level expression in breast and pancreatic cancer cell lines. Persistent stimulation by proinflammatory cytokines may contribute to increased MUC1 transcription by tumor cells. ^ T47D breast cancer cells and normal human mammary epithelial cells (HMEC) were used to determine the roles of the κB site and SBE in basal and stimulated expression of MUC1. Treatment of T47D cells and HMEC with interferon-γ (IFNγ) alone enhanced MUC1 expression at the level of transcription, and the effect of IFNγ was further stimulated by tumor necrosis factor-α (TNFα). MUC1 responsiveness to these cytokines was modest in T47D cells but clearly evident in HMEC. Transient transfection of T47D cells with mutant MUC1 promoter constructs revealed that the κB site at −589/−580 and the SBE at −503/−495 and were required for cooperative stimulation by TNFα and IFNγ. Electrophoretic mobility shift assays (EMSA) revealed that the synergy was mediated not by cooperative binding of transcription factors but by the independent actions of STAT1α and NFκB p65 on their respective binding sites. Independent mutations in the κB site and SBE abrogated cytokine responsiveness and reduced basal MUC1 promoter activity by 45–50%. However, only the κB site appeared to be constitutively activated in T47D cells, in part by NFκB p65. These findings implicate two cytokine response elements in the 5 ′ flanking region of MUC1, specifically a κB site and a STAT binding element, in overexpression of MUC1 in breast cancer cells. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Isolation and characterization of a novel human Mix -like homeobox gene MIXL

Molecular events involved in specification of early hematopoietic system are not well known. In Xenopus, a paired-box homeodomain family (Mix.1–4) has been implicated in this process. Although Mix-like homeobox genes have been isolated from zebrafish (bon), chicken (CMIX) and mice (MmI/MIXL1), isolation of a human Mix-like gene has remained elusive. ^ We have recently isolated and characterized a novel human Mix-like homeobox gene with a predicted open reading frame of 232 amino acids designated the Mix.1 homeobox (Xenopus laevis)-like gene (MIXL). The overall identity of this novel protein to CMIX and MmI/MIXL1 is 41% and 69%, respectively. However, the identity in the homeodomain is 66% to that of Xenopus Mix.1, 79% to that of CMIX, and 94% to that of MmI/MIXL1. In normal hematopoiesis, MIXL expression appears to be restricted immature B and T lymphoid cells. Several acute leukemic cell lines of B, T and myeloid lineages express MIXL suggesting a survival/block in differentiation advantage. Furthermore, Xenopus animal cap assay revealed that MIXL could induce expression of the α-globin gene, suggesting a functional conservation of the homeodomain. ^ Biochemical analysis revealed that MIXL proteins are phosphorylated at multiple sites. Immunoprecipitation and immunoblotting confirmed that MIXL is tyrosine phosphorylated. Mutational analysis determined that Tyr20 appears to be the site for phosphorylation. However, deletion analysis preliminarily showed that the proline-rich domain appears not to be necessary for tyrosine phosphorylation. The novel finding will help us make a deeper understanding of the regulation on homeodomain proteins by rarely reported tyrosine phosphorylation. ^ Taken together, isolation of the MIXL gene is the first step toward understanding novel regulatory circuits in early hematopoietic differentiation and malignant transformation. ^