Searching for the majority: algorithms of voluntary control.

Voluntary control of information processing is crucial to allocate resources and prioritize the processes that are most important under a given situation; the algorithms underlying such control, however, are often not clear. We investigated possible algorithms of control for the performance of the majority function, in which participants searched for and identified one of two alternative categories (left or right pointing arrows) as composing the majority in each stimulus set. We manipulated the amount (set size of 1, 3, and 5) and content (ratio of left and right pointing arrows within a set) of the inputs to test competing hypotheses regarding mental operations for information processing. Using a novel measure based on computational load, we found that reaction time was best predicted by a grouping search algorithm as compared to alternative algorithms (i.e., exhaustive or self-terminating search). The grouping search algorithm involves sampling and resampling of the inputs before a decision is reached. These findings highlight the importance of investigating the implications of voluntary control via algorithms of mental operations.

Interruptions in Workflow for RNs in a Level One Trauma Center

An understanding of interruptions in healthcare is important for the design, implementation, and evaluation of health information systems and for the management of clinical workflow and medical errors. The purpose of this study is to identify and classify the types of interruptions experienced by Emergency Department(ED) nurses working in a Level One Trauma Center. This was an observational field study of Registered Nurses (RNs) employed in a Level One Trauma Center using the shadowing method. Results of the study indicate that nurses were both recipients and initiators of interruptions. Telephones, pagers, and face-to-face conversations were the most common sources of interruptions. Unlike other industries, the healthcare community has not systematically studied interruptions in clinical settings to determine and weigh the necessity of the interruption against their sometimes negative results such as medical errors, decreased efficiency, and increased costs. Our study presented here is an initial step to understand the nature, causes, and effects of interruptions, thereby improving both the quality of healthcare and patient safety. We developed an ethnographic data collection technique and a data coding method for the capturing and analysis of interruptions. The interruption data we collected are systematic, comprehensive, and close to exhaustive. They confirmed the findings from earlier studies by other researchers that interruptions are frequent events in critical care and other healthcare settings. We are currently using these data to analyze the workflow dynamics of ED clinicians, to identify the bottlenecks of information flow, and to develop interventions to improve the efficiency of emergency care through the management of interruptions.

Interruptions in workflow for RNs in a Level One Trauma Center.

An understanding of interruptions in healthcare is important for the design, implementation, and evaluation of health information systems and for the management of clinical workflow and medical errors. The purpose of this study is to identify and classify the types of interruptions experienced by ED nurses working in a Level One Trauma Center. This was an observational field study of Registered Nurses employed in a Level One Trauma Center using the shadowing method. Results of the study indicate that nurses were both recipients and initiators of interruptions. Telephone, pagers, and face-to-face conversations were the most common sources of interruptions. Unlike other industries, the outcomes caused by interruptions resulting in medical errors, decreased efficiency and increased cost have not been systematically studied in healthcare. Our study presented here is an initial step to understand the nature, causes, and effects of interruptions, and to develop interventions to manage interruptions to improve healthcare quality and patient safety. We developed an ethnographic data collection technique and a data coding method for the capturing and analysis of interruptions. The interruption data we collected are systematic, comprehensive, and close to exhaustive. They confirmed the findings from early studies by other researchers that interruptions are frequent events in critical care and other healthcare settings. We are currently using these data to analyze the workflow dynamics of ED clinicians, identify the bottlenecks of information flow, and develop interventions to improve the efficiency of emergency care through the management of interruptions.

New algorithms for automated phylogenetic reconstruction using artificial intelligence and data mining techniques

Academic and industrial research in the late 90s have brought about an exponential explosion of DNA sequence data. Automated expert systems are being created to help biologists to extract patterns, trends and links from this ever-deepening ocean of information. Two such systems aimed on retrieving and subsequently utilizing phylogenetically relevant information have been developed in this dissertation, the major objective of which was to automate the often difficult and confusing phylogenetic reconstruction process. ^ Popular phylogenetic reconstruction methods, such as distance-based methods, attempt to find an optimal tree topology (that reflects the relationships among related sequences and their evolutionary history) by searching through the topology space. Various compromises between the fast (but incomplete) and exhaustive (but computationally prohibitive) search heuristics have been suggested. An intelligent compromise algorithm that relies on a flexible “beam” search principle from the Artificial Intelligence domain and uses the pre-computed local topology reliability information to adjust the beam search space continuously is described in the second chapter of this dissertation. ^ However, sometimes even a (virtually) complete distance-based method is inferior to the significantly more elaborate (and computationally expensive) maximum likelihood (ML) method. In fact, depending on the nature of the sequence data in question either method might prove to be superior. Therefore, it is difficult (even for an expert) to tell a priori which phylogenetic reconstruction method—distance-based, ML or maybe maximum parsimony (MP)—should be chosen for any particular data set. ^ A number of factors, often hidden, influence the performance of a method. For example, it is generally understood that for a phylogenetically “difficult” data set more sophisticated methods (e.g., ML) tend to be more effective and thus should be chosen. However, it is the interplay of many factors that one needs to consider in order to avoid choosing an inferior method (potentially a costly mistake, both in terms of computational expenses and in terms of reconstruction accuracy.) ^ Chapter III of this dissertation details a phylogenetic reconstruction expert system that selects a superior proper method automatically. It uses a classifier (a Decision Tree-inducing algorithm) to map a new data set to the proper phylogenetic reconstruction method. ^

The information bottleneck method for genome-wide association studies

In population studies, most current methods focus on identifying one outcome-related SNP at a time by testing for differences of genotype frequencies between disease and healthy groups or among different population groups. However, testing a great number of SNPs simultaneously has a problem of multiple testing and will give false-positive results. Although, this problem can be effectively dealt with through several approaches such as Bonferroni correction, permutation testing and false discovery rates, patterns of the joint effects by several genes, each with weak effect, might not be able to be determined. With the availability of high-throughput genotyping technology, searching for multiple scattered SNPs over the whole genome and modeling their joint effect on the target variable has become possible. Exhaustive search of all SNP subsets is computationally infeasible for millions of SNPs in a genome-wide study. Several effective feature selection methods combined with classification functions have been proposed to search for an optimal SNP subset among big data sets where the number of feature SNPs far exceeds the number of observations. ^ In this study, we take two steps to achieve the goal. First we selected 1000 SNPs through an effective filter method and then we performed a feature selection wrapped around a classifier to identify an optimal SNP subset for predicting disease. And also we developed a novel classification method-sequential information bottleneck method wrapped inside different search algorithms to identify an optimal subset of SNPs for classifying the outcome variable. This new method was compared with the classical linear discriminant analysis in terms of classification performance. Finally, we performed chi-square test to look at the relationship between each SNP and disease from another point of view. ^ In general, our results show that filtering features using harmononic mean of sensitivity and specificity(HMSS) through linear discriminant analysis (LDA) is better than using LDA training accuracy or mutual information in our study. Our results also demonstrate that exhaustive search of a small subset with one SNP, two SNPs or 3 SNP subset based on best 100 composite 2-SNPs can find an optimal subset and further inclusion of more SNPs through heuristic algorithm doesn't always increase the performance of SNP subsets. Although sequential forward floating selection can be applied to prevent from the nesting effect of forward selection, it does not always out-perform the latter due to overfitting from observing more complex subset states. ^ Our results also indicate that HMSS as a criterion to evaluate the classification ability of a function can be used in imbalanced data without modifying the original dataset as against classification accuracy. Our four studies suggest that Sequential Information Bottleneck(sIB), a new unsupervised technique, can be adopted to predict the outcome and its ability to detect the target status is superior to the traditional LDA in the study. ^ From our results we can see that the best test probability-HMSS for predicting CVD, stroke,CAD and psoriasis through sIB is 0.59406, 0.641815, 0.645315 and 0.678658, respectively. In terms of group prediction accuracy, the highest test accuracy of sIB for diagnosing a normal status among controls can reach 0.708999, 0.863216, 0.639918 and 0.850275 respectively in the four studies if the test accuracy among cases is required to be not less than 0.4. On the other hand, the highest test accuracy of sIB for diagnosing a disease among cases can reach 0.748644, 0.789916, 0.705701 and 0.749436 respectively in the four studies if the test accuracy among controls is required to be at least 0.4. ^ A further genome-wide association study through Chi square test shows that there are no significant SNPs detected at the cut-off level 9.09451E-08 in the Framingham heart study of CVD. Study results in WTCCC can only detect two significant SNPs that are associated with CAD. In the genome-wide study of psoriasis most of top 20 SNP markers with impressive classification accuracy are also significantly associated with the disease through chi-square test at the cut-off value 1.11E-07. ^ Although our classification methods can achieve high accuracy in the study, complete descriptions of those classification results(95% confidence interval or statistical test of differences) require more cost-effective methods or efficient computing system, both of which can't be accomplished currently in our genome-wide study. We should also note that the purpose of this study is to identify subsets of SNPs with high prediction ability and those SNPs with good discriminant power are not necessary to be causal markers for the disease.^

Evaluation of therapist and client language in Motivational Interviewing (MI) sessions: A secondary analysis of data from the Southern Methodist Alcohol Research Trial (SMART) study

In the United States, “binge” drinking among college students is an emerging public health concern due to the significant physical and psychological effects on young adults. The focus is on identifying interventions that can help decrease high-risk drinking behavior among this group of drinkers. One such intervention is Motivational interviewing (MI), a client-centered therapy that aims at resolving client ambivalence by developing discrepancy and engaging the client in change talk. Of late, there is a growing interest in determining the active ingredients that influence the alliance between the therapist and the client. This study is a secondary analysis of the data obtained from the Southern Methodist Alcohol Research Trial (SMART) project, a dismantling trial of MI and feedback among heavy drinking college students. The present project examines the relationship between therapist and client language in MI sessions on a sample of “binge” drinking college students. Of the 126 SMART tapes, 30 tapes (‘MI with feedback’ group = 15, ‘MI only’ group = 15) were randomly selected for this study. MISC 2.1, a mutually exclusive and exhaustive coding system, was used to code the audio/videotaped MI sessions. Therapist and client language were analyzed for communication characteristics. Overall, therapists adopted a MI consistent style and clients were found to engage in change talk. Counselor acceptance, empathy, spirit, and complex reflections were all significantly related to client change talk (p-values ranged from 0.001 to 0.047). Additionally, therapist ‘advice without permission’ and MI Inconsistent therapist behaviors were strongly correlated with client sustain talk (p-values ranged from 0.006 to 0.048). Simple linear regression models showed a significant correlation between MI consistent (MICO) therapist language (independent variable) and change talk (dependent variable) and MI inconsistent (MIIN) therapist language (independent variable) and sustain talk (dependent variable). The study has several limitations such as small sample size, self-selection bias, poor inter-rater reliability for the global scales and the lack of a temporal measure of therapist and client language. Future studies might consider a larger sample size to obtain more statistical power. In addition the correlation between therapist language, client language and drinking outcome needs to be explored.^

SUPERFUND: AN ANALYSIS OF IMPLEMENTATION FAILURE (CERCLA, HEALTH LAW POLICY)

In December, 1980, following increasing congressional and constituent-interest in problems associated with hazardous waste, the Comprehensive Environmental Recovery, Compensation and Liability Act (CERCLA) was passed. During its development, the legislative initiative was seriously compromised which resulted in a less exhaustive approach than was formerly sought. Still, CERCLA (Superfund) which established, among other things, authority to clean up abandoned waste dumps and to respond to emergencies caused by releases of hazardous substances was welcomed by many as an important initial law critical to the cleanup of the nation's hazardous waste. Expectations raised by passage of this bill were tragically unmet. By the end of four years, only six sites had been declared by the EPA as cleaned. Seemingly, even those determinations were liberal; of the six sites, two were identified subsequently as requiring further cleanup.^ This analysis is focused upon the implementation failure of the Superfund. In light of that focus, discussion encompasses development of linkages between flaws in the legislative language and foreclosure of chances for implementation success. Specification of such linkages is achieved through examination of the legislative initiative, identification of its flaws and characterization of attendant deficits in implementation ability. Subsequent analysis is addressed to how such legislative frailities might have been avoided and to attendant regulatory weaknesses which have contributed to implementation failure. Each of these analyses are accomplished through application of an expanded approach to the backward mapping analytic technique as presented by Elmore. Results and recommendations follow.^ Consideration is devoted to a variety of regulatory issues as well as to those pertinent to legislative and implementation analysis. Problems in assessing legal liability associated with hazardous waste management are presented, as is a detailed review of the legislative development of Superfund, and its initial implementation by Gorsuch's EPA. ^

A practice-based culminating experience: Writing a HRSA grant application with Texas Organ Sharing Alliance for public education efforts to increase solid organ donation

In November 2010, nearly 110,000 people in the United States were waiting for organs for transplantation. Despite the fact that the organ donor registration rate has doubled in the last year, Texas has the lowest registration rate in the nation. Due to the need for improved registration rates in Texas, this practice-based culminating experience was to write an application for federal funding for the central Texas organ procurement organization, Texas Organ Sharing Alliance. The culminating experience has two levels of significance for public health – (1) to engage in an activity to promote organ donation registration, and (2) to provide professional experience in grant writing. ^ The process began with a literature review. The review was to identify successful intervention activities in motivating organ donation registration that could be used in intervention design for the grant application. Conclusions derived from the literature review included (1) the need to specifically encourage family discussions, (2) religious and community leaders can be leveraged to facilitate organ donation conversations in families, (3) communication content must be culturally sensitive and (4) ethnic disparities in transplantation must be acknowledged and discussed.^ Post the literature review; the experience followed a five step process of developing the grant application. The steps included securing permission to proceed, assembling a project team, creation of a project plan and timeline, writing each element of the grant application including the design of proposed intervention activities, and completion of the federal grant application. ^ After the grant application was written, an evaluation of the grant writing process was conducted. Opportunities for improvement were identified. The first opportunity was the need for better timeline management to allow for review of the application by an independent party, iterative development of the budget proposal, and development of collaborative partnerships. Another improvement opportunity was the management of conflict regarding the design of the intervention that stemmed from marketing versus evidence-based approaches. The most important improvement opportunity was the need to develop a more exhaustive evaluation plan.^ Eight supplementary files are attached to appendices: Feasibility Discussion in Appendix 1, Grant Guidance and Workshop Notes in Appendix 2, Presentation to Texas Organ Sharing Alliance in Appendix 3, Team Recruitment Presentation in Appendix 5, Grant Project Narrative in Appendix 7, Federal Application Form in Appendix 8, and Budget Workbook with Budget Narrative in Appendix 9.^

Endemic tuberculosis, the homeless, and public transportation: A merging of geographical information systems surveillance and the Houston Tuberculosis Initiative Surveillance project

To reach the goals established by the Institute of Medicine (IOM) and the Centers for Disease Control's (CDC) STOP TB USA, measures must be taken to curtail a future peak in Tuberculosis (TB) incidence and speed the currently stagnant rate of TB elimination. Both efforts will require, at minimum, the consideration and understanding of the third dimension of TB transmission: the location-based spread of an airborne pathogen among persons known and unknown to each other. This consideration will require an elucidation of the areas within the U.S. that have endemic TB. The Houston Tuberculosis Initiative (HTI) was a population-based active surveillance of confirmed Houston/Harris County TB cases from 1995–2004. Strengths in this dataset include the molecular characterization of laboratory confirmed cases, the collection of geographic locations (including home addresses) frequented by cases, and the HTI time period that parallels a decline in TB incidence in the United States (U.S.). The HTI dataset was used in this secondary data analysis to implement a GIS analysis of TB cases, the locations frequented by cases, and their association with risk factors associated with TB transmission. ^ This study reports, for the first time, the incidence of TB among the homeless in Houston, Texas. The homeless are an at-risk population for TB disease, yet they are also a population whose TB incidence has been unknown and unreported due to their non-enumeration. The first section of this dissertation identifies local areas in Houston with endemic TB disease. Many Houston TB cases who reported living in these endemic areas also share the TB risk factor of current or recent homelessness. Merging the 2004–2005 Houston enumeration of the homeless with historical HTI surveillance data of TB cases in Houston enabled this first-time report of TB risk among the homeless in Houston. The homeless were more likely to be US-born, belong to a genotypic cluster, and belong to a cluster of a larger size. The calculated average incidence among homeless persons was 411/100,000, compared to 9.5/100,000 among housed. These alarming rates are not driven by a co-infection but by social determinants. The unsheltered persons were hospitalized more days and required more follow-up time by staff than those who reported a steady housing situation. The homeless are a specific example of the increased targeting of prevention dollars that could occur if TB rates were reported for specific areas with known health disparities rather than as a generalized rate normalized over a diverse population. ^ It has been estimated that 27% of Houstonians use public transportation. The city layout allows bus routes to run like veins connecting even the most diverse of populations within the metropolitan area. Secondary data analysis of frequent bus use (defined as riding a route weekly) among TB cases was assessed for its relationship with known TB risk factors. The spatial distribution of genotypic clusters associated with bus use was assessed, along with the reported routes and epidemiologic-links among cases belonging to the identified clusters. ^ TB cases who reported frequent bus use were more likely to have demographic and social risk factors associated with poverty, immune suppression and health disparities. An equal proportion of bus riders and non-bus riders were cultured for Mycobacterium tuberculosis, yet 75% of bus riders were genotypically clustered, indicating recent transmission, compared to 56% of non-bus riders (OR=2.4, 95%CI(2.0, 2.8), p<0.001). Bus riders had a mean cluster size of 50.14 vs. 28.9 (p<0.001). Second order spatial analysis of clustered fingerprint 2 (n=122), a Beijing family cluster, revealed geographic clustering among cases based on their report of bus use. Univariate and multivariate analysis of routes reported by cases belonging to these clusters found that 10 of the 14 clusters were associated with use. Individual Metro routes, including one route servicing the local hospitals, were found to be risk factors for belonging to a cluster shown to be endemic in Houston. The routes themselves geographically connect the census tracts previously identified as having endemic TB. 78% (15/23) of Houston Metro routes investigated had one or more print groups reporting frequent use for every HTI study year. We present data on three specific but clonally related print groups and show that bus-use is clustered in time by route and is the only known link between cases in one of the three prints: print 22. (Abstract shortened by UMI.)^

Modeling Techniques for the High-Resolution Interpretation of Cryo-Electron Microscopy Reconstructions

Essential biological processes are governed by organized, dynamic interactions between multiple biomolecular systems. Complexes are thus formed to enable the biological function and get dissembled as the process is completed. Examples of such processes include the translation of the messenger RNA into protein by the ribosome, the folding of proteins by chaperonins or the entry of viruses in host cells. Understanding these fundamental processes by characterizing the molecular mechanisms that enable then, would allow the (better) design of therapies and drugs. Such molecular mechanisms may be revealed trough the structural elucidation of the biomolecular assemblies at the core of these processes. Various experimental techniques may be applied to investigate the molecular architecture of biomolecular assemblies. High-resolution techniques, such as X-ray crystallography, may solve the atomic structure of the system, but are typically constrained to biomolecules of reduced flexibility and dimensions. In particular, X-ray crystallography requires the sample to form a three dimensional (3D) crystal lattice which is technically di‑cult, if not impossible, to obtain, especially for large, dynamic systems. Often these techniques solve the structure of the different constituent components within the assembly, but encounter difficulties when investigating the entire system. On the other hand, imaging techniques, such as cryo-electron microscopy (cryo-EM), are able to depict large systems in near-native environment, without requiring the formation of crystals. The structures solved by cryo-EM cover a wide range of resolutions, from very low level of detail where only the overall shape of the system is visible, to high-resolution that approach, but not yet reach, atomic level of detail. In this dissertation, several modeling methods are introduced to either integrate cryo-EM datasets with structural data from X-ray crystallography, or to directly interpret the cryo-EM reconstruction. Such computational techniques were developed with the goal of creating an atomic model for the cryo-EM data. The low-resolution reconstructions lack the level of detail to permit a direct atomic interpretation, i.e. one cannot reliably locate the atoms or amino-acid residues within the structure obtained by cryo-EM. Thereby one needs to consider additional information, for example, structural data from other sources such as X-ray crystallography, in order to enable such a high-resolution interpretation. Modeling techniques are thus developed to integrate the structural data from the different biophysical sources, examples including the work described in the manuscript I and II of this dissertation. At intermediate and high-resolution, cryo-EM reconstructions depict consistent 3D folds such as tubular features which in general correspond to alpha-helices. Such features can be annotated and later on used to build the atomic model of the system, see manuscript III as alternative. Three manuscripts are presented as part of the PhD dissertation, each introducing a computational technique that facilitates the interpretation of cryo-EM reconstructions. The first manuscript is an application paper that describes a heuristics to generate the atomic model for the protein envelope of the Rift Valley fever virus. The second manuscript introduces the evolutionary tabu search strategies to enable the integration of multiple component atomic structures with the cryo-EM map of their assembly. Finally, the third manuscript develops further the latter technique and apply it to annotate consistent 3D patterns in intermediate-resolution cryo-EM reconstructions. The first manuscript, titled An assembly model for Rift Valley fever virus, was submitted for publication in the Journal of Molecular Biology. The cryo-EM structure of the Rift Valley fever virus was previously solved at 27Å-resolution by Dr. Freiberg and collaborators. Such reconstruction shows the overall shape of the virus envelope, yet the reduced level of detail prevents the direct atomic interpretation. High-resolution structures are not yet available for the entire virus nor for the two different component glycoproteins that form its envelope. However, homology models may be generated for these glycoproteins based on similar structures that are available at atomic resolutions. The manuscript presents the steps required to identify an atomic model of the entire virus envelope, based on the low-resolution cryo-EM map of the envelope and the homology models of the two glycoproteins. Starting with the results of the exhaustive search to place the two glycoproteins, the model is built iterative by running multiple multi-body refinements to hierarchically generate models for the different regions of the envelope. The generated atomic model is supported by prior knowledge regarding virus biology and contains valuable information about the molecular architecture of the system. It provides the basis for further investigations seeking to reveal different processes in which the virus is involved such as assembly or fusion. The second manuscript was recently published in the of Journal of Structural Biology (doi:10.1016/j.jsb.2009.12.028) under the title Evolutionary tabu search strategies for the simultaneous registration of multiple atomic structures in cryo-EM reconstructions. This manuscript introduces the evolutionary tabu search strategies applied to enable a multi-body registration. This technique is a hybrid approach that combines a genetic algorithm with a tabu search strategy to promote the proper exploration of the high-dimensional search space. Similar to the Rift Valley fever virus, it is common that the structure of a large multi-component assembly is available at low-resolution from cryo-EM, while high-resolution structures are solved for the different components but lack for the entire system. Evolutionary tabu search strategies enable the building of an atomic model for the entire system by considering simultaneously the different components. Such registration indirectly introduces spatial constrains as all components need to be placed within the assembly, enabling the proper docked in the low-resolution map of the entire assembly. Along with the method description, the manuscript covers the validation, presenting the benefit of the technique in both synthetic and experimental test cases. Such approach successfully docked multiple components up to resolutions of 40Å. The third manuscript is entitled Evolutionary Bidirectional Expansion for the Annotation of Alpha Helices in Electron Cryo-Microscopy Reconstructions and was submitted for publication in the Journal of Structural Biology. The modeling approach described in this manuscript applies the evolutionary tabu search strategies in combination with the bidirectional expansion to annotate secondary structure elements in intermediate resolution cryo-EM reconstructions. In particular, secondary structure elements such as alpha helices show consistent patterns in cryo-EM data, and are visible as rod-like patterns of high density. The evolutionary tabu search strategy is applied to identify the placement of the different alpha helices, while the bidirectional expansion characterizes their length and curvature. The manuscript presents the validation of the approach at resolutions ranging between 6 and 14Å, a level of detail where alpha helices are visible. Up to resolution of 12 Å, the method measures sensitivities between 70-100% as estimated in experimental test cases, i.e. 70-100% of the alpha-helices were correctly predicted in an automatic manner in the experimental data. The three manuscripts presented in this PhD dissertation cover different computation methods for the integration and interpretation of cryo-EM reconstructions. The methods were developed in the molecular modeling software Sculptor (http://sculptor.biomachina.org) and are available for the scientific community interested in the multi-resolution modeling of cryo-EM data. The work spans a wide range of resolution covering multi-body refinement and registration at low-resolution along with annotation of consistent patterns at high-resolution. Such methods are essential for the modeling of cryo-EM data, and may be applied in other fields where similar spatial problems are encountered, such as medical imaging.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^