RNA binding characteristics and overall topology of the vaccinia virus polyadenylation complex

mRNA 3′ polyadenylation is central to mRNA biogenesis in prokaryotes and eukaryotes, and is implicated in numerous aspects of mRNA metabolism, including efficiency of mRNA export from the nucleus, message stability, and initiation of translation. However, due to the great complexity of the eukaryotic polyadenylation apparatus, the mechanisms of RNA 3 ′ end processing have remained elusive. Although the RNA processing reactions leading to polyadenylated messenger RNA have been studied in many systems, and much progress has been made, a complete understanding of the biochemistry of the poly(A) polymerase enzyme is still lacking. My research uses Vaccinia virus as a model system to gain a better understanding of this complicated polyadenylation process, which consist of RNA binding, catalysis and polymerase translocation. ^ Vaccinia virus replicates in the cytoplasm of its host cell, so it must employ its own poly(A) polymerase (PAP), a heterodimer of two virus encoded proteins, VP55 and VP39. VP55 is the catalytic subunit, adding 30 adenylates to a non-polyadenylated RNA in a rapid processive manner before abruptly changing to a slow, non-processive mode of adenylate addition and dissociating from the RNA. VP39 is the stimulatory subunit. It has no polyadenylation catalytic activity by itself, but when associated with VP55 it facilitates the semi-processive synthesis of tails several hundred adenylates in length. ^ Oligonucleotide selection and competition studies have shown that the heterodimer binds a minimal motif of (rU)2 (N)25 U, the “heterodimer binding motif”, within an oligonucleotide, and its primer selection for polyadenylation is base-type specific. ^ Crosslinking studies using photosensitive uridylate analogs show that within a VP55-VP39-primer ternary complex, VP55 comes into contact with all three required uridylates, while VP39 only contacts the downstream uridylate. Further studies, using a backbone-anchored photosensitive crosslinker show that both PAP subunits are in close proximity to the downstream −10 to −21 region of 50mer model primers containing the heterodimer binding motif. This equal crosslinking to both subunits suggests that the dimerization of VP55 and VP39 creates either a cleft or a channel between the two subunits through which this region of RNA passes. ^ Peptide mapping studies of VP39 covalently crosslinked to the oligonucleotide have identified residue R107 as the amino acid in close proximity to the −10 uridylate. This helps us project a conceptual model onto the known physical surface of this subunit. In the absence of any tertiary structural data for VP55, we have used a series of oligonucleotide selection assays, as well as crosslinking, nucleotide transfer assays, and gel shift assays to gain insight into the requirements for binding, polyadenylation and translocation. Collectively, these data allow us to put together a comprehensive model of the structure and function of the polyadenylation ternary complex consisting of VP39, VP55 and RNA. ^

The association of area socioeconomic status and cancer screening: A systematic review and multilevel study

Background. The gap between actual and ideal rates of routine cancer screening in the U.S., particularly for colorectal cancer screening (CRCS) (1;2), is responsible for an unnecessary burden of morbidity and mortality, particularly for disadvantaged groups. Knowledge about the effects of individual and area influences is being advanced by a growing body of research that has examined the association of area socioeconomic status (SES) and cancer screening after controlling for individual SES. The findings from this emerging and heterogeneous research in the cancer screening literature have been mixed. Moreover, multilevel studies in this area have not yet adequately explored the possibility of differential associations by population subgroup, despite some evidence suggesting gender-specific effects. ^ Objectives and methods. This dissertation reports on a systematic review of studies on the association of area SES and cancer screening and a multilevel study of the association between area SES and CRCS. The specific aims of the systematic review are to: (1) describe the study designs, constructs, methods, and measures; (2) describe the association of area SES and cancer screening; and (3) identify neglected areas of research. ^ The empiric study linked a pooled sample of respondents aged ≥50 years without a personal history of colorectal cancer from the 2003 and 2005 California Health Interview Surveys with a comprehensive set of census-tract level area SES measures from the 2000 U.S. Census. Two-level random intercept models were used to test 2 hypotheses: (1) area SES will be associated with adherence to two modalities of CRCS after controlling for individual SES; and (2) gender will moderate the relationship between area socioeconomic status and adherence to both modalities of CRCS. ^ Results. The systematic review identified 19 eligible studies that demonstrated variability in study designs, methods, constructs, and measures. The majority of tested associations were either not statistically significant or significant and in the positive direction, indicating that as area SES increased, the odds of CRCS increased. The multilevel study demonstrated that while multiple aspects of area SES were associated with CRCS after controlling for individual SES, associations differed by screening modality and in the case of endoscopy, they also differed by gender. ^ Conclusions. Conceptual and methodologic heterogeneity and weaknesses in the literature to date limit definitive conclusions about the underlying relationships between area SES and cancer screening. The multilevel study provided partial support for both hypotheses. Future research should continue to explore the role of gender as a moderating influence with the aim of identifying the mechanisms linking area SES and cancer prevention behaviors. ^

An Sp1/Sp3 site polymorphism associated with hypermethylation of the candidate tumor suppressor gene RIL in cancer

Gene silencing due to promoter methylation is an alternative to mutations and deletions, which inactivate tumor suppressor genes (TSG) in cancer. We identified RIL by Methylated CpG Island Amplification technique as a novel aberrantly methylated gene. RIL is expressed in normal tissues and maps to the 5q31 region, frequently deleted in leukemias. We found methylation of RIL in 55/80 (69%) cancer cell lines, with highest methylation in leukemia and colon. We also observed methylation in 46/80 (58%) primary tumors, whereas normal tissues showed substantially lower degrees of methylation. RIL expression was lost in 13/16 cancer cell lines and was restored by demethylating agent. Screening of 38 cell lines and 13 primary cancers by SSCP revealed no mutations in RIL, suggesting that methylation and LOH are the primary inactivation mechanisms. Stable transfection of RIL into colorectal cancer cells resulted in reduction in cell growth, clonogenicity, and increased apoptosis upon UVC treatment, suggesting that RIL is a good candidate TSG. ^ In searching for a cause of RIL hypermethylation, we identified a 12-bp polymorphic sequence around the transcription start site of the gene that creates a long allele containing 3CTC repeat. Evolutionary studies suggested that the long allele appeared late in evolution due to insertion. Using bisulfite sequencing, in cancers heterozygous for RIL, we found that the short allele is 4.4-fold more methylated than the long allele (P = 0.003). EMSA results suggested binding of factor(s) to the inserted region of the long allele, but not to the short. EMSA mutagenesis and competition studies, as well as supershifts using nuclear extracts or recombinant Sp1 strongly indicated that those DNA binding proteins are Sp1 and Sp3. Transient transfections of RIL allele-specific expression constructs showed less than 2-fold differences in luciferase activity, suggesting no major effects of the additional Sp1 site on transcription. However, stable transfection resulted in 3-fold lower levels of transcription from the short allele 60 days post-transfection, consistent with the concept that the polymorphic Sp1 site protects against time-dependent silencing. Thus, an insertional polymorphism in the RIL promoter creates an additional Sp1/Sp3 site, which appears to protect it from silencing and methylation in cancer. ^

Factors associated with home health care costs

Characteristics of Medicare-certified home health agencies in Texas and the contributions of selected agency characteristics on home health care costs were examined. Cost models were developed and estimated for both nursing and total visit costs using multiple regression procedures. The models included home health agency size, profit status, control, hospital-based affiliation, contract-cost ratio, service provision, competition, urban-rural input-price differences, and selected measures of patient case-mix. The study population comprised 314 home health agencies in Texas that had been certified at least one year on July, 1, 1986. Data for the analysis were obtained from Medicare Cost Reports for fiscal year ending between July 1, 1985 to June 30, 1986.^ Home health agency size, as measured by the logs of nursing and total visits, has a statistically significant negative linear relationship with nursing visit and total visit costs. Nursing and total visit costs decrease at a declining rate as size increases. The size-cost relationship is not altered when controlling for any other agency characteristic. The number of visits per patient per year, a measure of patient case-mix, is also negatively related to costs, suggesting that costs decline with care of chronic patients. Hospital-based affiliation and urban location are positively associated with costs. Together, the four characteristics explain 19 percent of the variance in nursing visit costs and 24 percent of the variance in total visit costs.^ Profit status and control, although correlated with other agency characteristics, exhibit no observable effect on costs. Although no relationship was found between costs and competition, contract cost ratio, or the provision on non-reimburseable services, no conclusions can be made due to problems with measurement of these variables. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^