Searching for the ideal DNA recognition code of covalent ligands

The combitiatorial approach restriction endonuclease protection selection and amplification REPSA was successfully used to determine ideal DNA interactions sites of covalent ligands. Unlike most other combinatorial methods, REPSA is based on inhibition of enzymatic cleavage by specific ligand-DNA complexes, which enables identification of binding sites of various ligands. However, the inherent nature of this technique posses a problem during selection of binding sites of covalent ligands. By modifying the technique according to the nature of the ligand, we demonstrate the flexibility of REPSA in identifying the preferred binding sites for monocovalent ligands, topoisomerase I and tallimustine, and the bicovalent ligand topoisomerase II. From among the preferred binding sites, we identified the consensus binding sequence of camptothecin induced topoisomerase I cleavage as ‘aGWT/Gc’, and tallimustine consensus sequences as ‘GTTCTA’ and ‘TTTTTTC’. We have shown for the first time that preferential binding of tallimustine occurs at sequences not previously reported. Furthermore, our data indicate that tallimustine is a novel DNA minor groove, guanine-specific alkylating agent. ^ Additionally, we have demonstrated in vivo that sequence-specific covalent DNA-binding small molecules have the ability to regulate transcription by inhibiting RNA polymerase II. Tallimustine, binding to its preferred sequences located in the 5′ untranslated region were an effective impediment for transcribing polymerase II. The ability of covalent binding small molecules to target predetermined DNA sequences located downstream of the promoter suggests a general approach for regulation of gene expression. ^

Endogenous nitric oxide regulates p53 signaling and DNA damage-induced apoptosis in melanoma cells

Nitric oxide is involved in a multitude of processes including regulation of vascular tone, neurotransmission, immunity, and cancer. Evidence suggests that nitric oxide exhibits anti-apoptotic activity in melanoma cells. Our laboratory showed that tumor expression of inducible nitric oxide synthase correlated strongly with poor survival in stage III and IV melanoma patients, suggesting an antagonistic role for nitric oxide in melanoma response to therapy. Therefore, the hypothesis that endogenously produced nitric oxide antagonizes chemotherapy-induced apoptosis was formed. Using cisplatin as a model for DNA damage in melanoma cell lines, the capacity of nitric oxide to regulate cell growth and apoptotic responses to cisplatin treatment was examined. The depletion of endogenously generated nitric oxide resulted in changes in cell cycle regulation and enhanced cisplatin-induced apoptosis in melanoma cells. Since nitric oxide was shown to be involved in the regulation of p53 stability, conformation and DNA binding activity, whether signaling through wild-type p53 in melanoma cells is regulated by nitric oxide was tested. Cisplatin-induced p53 accumulation and p21Waf1/Cip1/Sdi1 expression in nitric oxide-depleted melanoma cells were found to be strongly suppressed. When p53 binding to the p21Waf1/Cip1/Sdi1 promoter was examined, it was found that nitric oxide depletion significantly reduced the cisplatin-induced formation of p53-DNA complexes. These results suggest that nitric oxide is required for activation of wild-type p53 after DNA damage in melanoma cells. Finally, whether signaling through p53 controls melanoma response to DNA damage was examined. Transfection of a plasmid containing a dominant negative form of mutated p53 inhibited p21 Waf1/Cip1/Sdi1 expression and concomitantly enhanced apoptosis after cisplatin treatment. These data suggest that the induction of wild-type p53 protects melanoma cells against DNA damage via the up-regulation of p21 Waf1/Cip1/Sdi1. Together, these data strongly support the model that endogenous nitric oxide is required for p53 activation and p21Waf1/Cip1/Sdi1 expression after DNA damage, which can enhance melanoma resistance to therapy. Thus, in context of melanoma cells with wild-type p53 , low levels of endogenous constitutively-produced nitric oxide appear to facilitate the activation of p53 in response to DNA damage, thereby allowing for cell cycle arrest via p21Waf1/Cip1/Sdi1 induction, adequate DNA repair, and ultimately enhanced resistance to apoptosis. ^

Water-soluble fullerene (C60) derivatives as nonviral gene-delivery vectors.

A new class of water-soluble C60 transfecting agents has been prepared using Hirsch-Bingel chemistry and assessed for their ability to act as gene-delivery vectors in vitro. In an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the C60 vectors in gene delivery and expression, several different C60 derivatives were synthesized to yield either positively charged, negatively charged, or neutral chemical functionalities under physiological conditions. These fullerene derivatives were then tested for their ability to transfect cells grown in culture with DNA carrying the green fluorescent protein (GFP) reporter gene. Statistically significant expression of GFP was observed for all forms of the C60 derivatives when used as DNA vectors and compared to the ability of naked DNA alone to transfect cells. However, efficient in vitro transfection was only achieved with the two positively charged C60 derivatives, namely, an octa-amino derivatized C60 and a dodeca-amino derivatized C60 vector. All C60 vectors showed an increase in toxicity in a dose-dependent manner. Increased levels of cellular toxicity were observed for positively charged C60 vectors relative to the negatively charged and neutral vectors. Structural analyses using dynamic light scattering and optical microscopy offered further insights into possible correlations between the various derivatized C60 compounds, the C60 vector/DNA complexes, their physical attributes (aggregation, charge) and their transfection efficiencies. Recently, similar Gd@C60-based compounds have demonstrated potential as advanced contrast agents for magnetic resonance imaging (MRI). Thus, the successful demonstration of intracellular DNA uptake, intracellular transport, and gene expression from DNA using C60 vectors suggests the possibility of developing analogous Gd@C60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Single-stranded DNA-binding proteins regulate the abundance of LIM domain and LIM domain-binding proteins.

The LIM domain-binding protein Ldb1 is an essential cofactor of LIM-homeodomain (LIM-HD) and LIM-only (LMO) proteins in development. The stoichiometry of Ldb1, LIM-HD, and LMO proteins is tightly controlled in the cell and is likely a critical determinant of their biological actions. Single-stranded DNA-binding proteins (SSBPs) were recently shown to interact with Ldb1 and are also important in developmental programs. We establish here that two mammalian SSBPs, SSBP2 and SSBP3, contribute to an erythroid DNA-binding complex that contains the transcription factors Tal1 and GATA-1, the LIM domain protein Lmo2, and Ldb1 and binds a bipartite E-box-GATA DNA sequence motif. In addition, SSBP2 was found to augment transcription of the Protein 4.2 (P4.2) gene, a direct target of the E-box-GATA-binding complex, in an Ldb1-dependent manner and to increase endogenous Ldb1 and Lmo2 protein levels, E-box-GATA DNA-binding activity, and P4.2 and beta-globin expression in erythroid progenitors. Finally, SSBP2 was demonstrated to inhibit Ldb1 and Lmo2 interaction with the E3 ubiquitin ligase RLIM, prevent RLIM-mediated Ldb1 ubiquitination, and protect Ldb1 and Lmo2 from proteasomal degradation. These results define a novel biochemical function for SSBPs in regulating the abundance of LIM domain and LIM domain-binding proteins.

Agrobacterium ParA/MinD-like VirC1 spatially coordinates early conjugative DNA transfer reactions.

Agrobacterium tumefaciens translocates T-DNA through a polar VirB/D4 type IV secretion (T4S) system. VirC1, a factor required for efficient T-DNA transfer, bears a deviant Walker A and other sequence motifs characteristic of ParA and MinD ATPases. Here, we show that VirC1 promotes conjugative T-DNA transfer by stimulating generation of multiple copies per cell of the T-DNA substrate (T-complex) through pairwise interactions with the processing factors VirD2 relaxase, VirC2, and VirD1. VirC1 also associates with the polar membrane and recruits T-complexes to cell poles, the site of VirB/D4 T4S machine assembly. VirC1 Walker A mutations abrogate T-complex generation and polar recruitment, whereas the native protein recruits T-complexes to cell poles independently of other polar processing factors (VirC2, VirD1) or T4S components (VirD4 substrate receptor, VirB channel subunits). We propose that A. tumefaciens has appropriated a progenitor ParA/MinD-like ATPase to promote conjugative DNA transfer by: (i) nucleating relaxosome assembly at oriT-like T-DNA border sequences and (ii) spatially positioning the transfer intermediate at the cell pole to coordinate substrate-T4S channel docking.

DNA-DAMAGING REACTIONS OF NEOCARZINOSTATIN (ANTIBIOTICS, DNA REPAIR, CYTOTOXICITY)

Sensitive assays utilizing a cell-free and an intracellular system were employed to study the molecular bases of the DNA-damaging reactions of neocarzinostatin (NCS). In the cell-free DNA system, super-helical form I DNA from the bacteriophage PM2 was used as the substrate. The three forms of DNA present after treatment with NCS were separated by agarose gel electrophoresis. When NCS-damaged DNA was assayed under neutral conditions, there was a progressive decrease in the amount of surviving form I DNA and a corresponding increase in form II (nicked, relaxed circular) DNA, but very little increase in form III (linear duplex) DNA. This indicates that NCS introduces primarily single-strand breaks. However later studies showed that there were some site-specific double-strand breaks mediated by NCS on PM2 DNA. Seven such specific sites were mapped on the PM2 genome. When the damage was assayed under nondenaturing alkaline conditions or with the apurinic/apyrimidinic endonuclease IV, there was a slightly greater decrease in the amount of surviving form I DNA compared with neutral conditions indicating the presence of some alkali-labile sites.^ NCS-mediated DNA damage and repair were examined with cultured Chinese hamster ovary (CHO) cells using either alkaline elution for analysis of single-strand breaks or neutral elution for analysis of double-strand breaks. Most of the strand breaks introduced by NCS were capable of being rejoined. However, there was a small amount of residual DNA damage remaining unrejoined at 24-hr after removal of the drug. The amount of residual DNA damage was higher in a CHO mutant cell line (EM9) having a higher sensitivity to killing by NCS than its parental strain (AA8). Other lesions, DNA-protein complexes and alkali-labile sites, were detected after NCS treatment but they constituted only a small fraction of the DNA damage.^ Based on the above information, it can be postulated that NCS introduces some very lethal DNA damage. It is likely that the lethal lesions are a subset of the total DNA lesions representing the residual DNA damage. This DNA damage may be composed of site-specific, unrejoinable double-strand breaks and are thus the primary lesion leading to NCS-mediated lethality.^

Roles of mismatch repair proteins in the recognition and processing of DNA interstrand crosslinks in human cells

DNA interstrand crosslinks (ICLs) are among the most toxic type of damage to a cell. Many ICL-inducing agents are widely used as therapeutic agents, e.g. cisplatin, psoralen. A bettor understanding of the cellular mechanism that eliminates ICLs is important for the improvement of human health. However, ICL repair is still poorly understood in mammals. Using a triplex-directed site-specific ICL model, we studied the roles of mismatch repair (MMR) proteins in ICL repair in human cells. We are also interested in using psoralen-conjugated triplex-forming oligonucleotides (TFOs) to direct ICLs to a specific site in targeted DNA and in the mammalian genomes. ^ MSH2 protein is the common subunit of two MMR recognition complexes, and MutSα and MutSβ. We showed that MSH2 deficiency renders human cell hypersensitive to psoralen ICLs. MMR recognition complexes bind specifically to triplex-directed psoralen ICLs in vitro. Together with the fact that psoralen ICL-induced repair synthesis is dramatically decreased in MSH2 deficient cell extracts, we demonstrated that MSH2 function is critical for the recognition and processing of psoralen ICLs in human cells. Interestingly, lack of MSH2 does not reduce the level of psoralen ICL-induced mutagenesis in human cells, suggesting that MSH2 does not contribute to error-generating repair of psoralen ICLs, and therefore, may represent a novel error-free mechanism for repairing ICLs. We also studied the role of MLH1, anther key protein in MMR, in the processing of psoralen ICLs. MLH1-deficient human cells are more resistant to psoralen plus UVA treatment. Importantly, MLH1 function is not required for the mutagenic repair of psoralen ICLs, suggesting that it is not involved in the error-generating repair of this type of DNA damage in human cells. ^ These are the first data indicating mismatch repair proteins may participate in a relatively error-free mechanism for processing psoralen ICL in human cells. Enhancement of MMR protein function relative to nucleotide excision repair proteins may reduce the mutagenesis caused by DNA ICLs in humans. ^ In order to specifically target ICLs to mammalian genes, we identified novel TFO target sequences in mouse and human genomes. Using this information, many critical mammalian genes can now be targeted by TFOs.^

A role for p53 in sensing DNA damage and triggering apoptotic responses to anticancer agents

The p53 tumor suppressor protein plays a major role in cellular responses to anticancer agents that target DNA. DNA damage triggers the accumulation of p53, resulting in the transactivation of genes, which induce cell cycle arrest to allow for repair of the damaged DNA, or signal apoptosis. The exact role that p53 plays in sensing DNA damage and the functional consequences remain to be investigated. The main goal of this project was to determine if p53 is directly involved in sensing DNA damage induced by anticancer agents and in mediating down-stream cellular responses. This was tested in two experimental models of DNA damage: (1) DNA strand termination caused by anticancer nucleoside analogs and (2) oxidative DNA damage induced by reactive oxygen species (ROS). Mobility shift assays demonstrated that p53 and DNA-PK/Ku form a complex that binds DNA containing the anticancer nucleoside analog gemcitabine monophosphate in vitro. Binding of the p53-DNA-PK/Ku complex to the analog-containing DNA inhibited DNA strand elongation. Furthermore, treatment of cells with gemcitabine resulted in the induction of apoptosis, which was associated with the accumulation of p53 protein, its phosphorylation, and nuclear localization, suggesting the activation of p53 to trigger apoptosis following gemcitabine induced DNA strand termination. The role of p53 as a DNA damage sensor was further demonstrated in response to oxidative DNA damage. Protein pull-down assays demonstrated that p53 complexes with OGG1 and APE, and binds DNA containing the oxidized DNA base 8-oxoG. Importantly, p53 enhances the activities of APE and OGG1 in excising the 8-oxoG residue as shown by functional assays in vitro. This correlated with the more rapid removal of 8-oxoG from DNA in intact cells with wild-type p53 exposed to exogenous ROS stress. Interestingly, persistent exposure to ROS resulted in the accelerated onset of apoptosis in cells with wild-type p53 when compared to isogenic cells lacking p53. Apoptosis in p53+/+ cells was associated with accumulation and phosphorylation of p53 and its nuclear localization. Taken together, these results indicate that p53 plays a key role in sensing DNA damage induced by anticancer nucleoside analogs and ROS, and in triggering down-stream apoptotic responses. This study provides new mechanistic insights into the functions of p53 in cellular responses to anticancer agents. ^