Cis-acting elements and developmental regulators govern toxin gene expression in Bacillus anthracis

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Mapping and characterization of the Xlsirt P11 RNA cis-acting localization element

In many organisms, polarity of the oocyte is established post-transcriptionally via subcellular RNA localization. Many RNAs are localized during oogenesis in Xenopus laevis, including Xlsirts ( Xenopus laevis short interspersed repeat transcripts) [Kloc, 1993]. Xlsirts constitute a large family defined by highly homologous repeat units 79–81 nucleotides in length. Endogenous Xlsirt RNAs use the METRO (Message Transport Organizer) pathway of localization, where RNAs are transported from the nucleus to the mitochondrial cloud in stage I oocytes. Secondly, RNAs anchor at the vegetal pole in stage II oocytes. Exogenous Xlsirt RNAs can also utilize the Late pathway of localization, which involves localization to the vegetal cortex during stage III of oogenesis and results in RNAs anchored in the cortex of the entire vegetal hemisphere. ^ The Xlsirts localization signal is contained within the repeat region. This study was designed to test the hypothesis that there are cis -acting localization elements in Xlsirts, and that higher order structure plays a role. Results of experiments on Xlsirt P11, a 1700 basepair (bp) family member, led to the conclusion that a 137-bp fragment of the repetitive region is necessary and sufficient for METRO and Late pathway localization. This analysis definitively demonstrates that the Xlsirt localization signal for the METRO and Late pathways reside within the repetitive region and not within the flanking regions. Analysis of Xlsirt linker scanning mutations revealed two METRO-pathway specific subelements, and one Late-pathway specific subelement. Functional, computer, and biochemical evidence relates the higher order structure of this element to its ability to function as a localization element. ^ Xlsirt 137 is 99% identical to the Xlsirt consensus sequence identified in this study, suggesting that it is the localization element for all localized Xlsirt family members. The repeat unit was reframed based on function, rather than arbitrarily based on sequence. This work supports the hypothesis presented in 1981 by George Spohr, who originally isolated the Xlsirts, which stated that the highly conserved repetitive elements must be constrained from variability due to some unknown function of the repeats themselves. These studies shed light on the mechanism of RNA localization, linking structure and function. ^

Characterization of the MLC box: A conserved {\it cis\/}-acting DNA element present in the chicken MLC1s/1c gene

The slow/cardiac alkali myosin light chain (MLC1s/1c) is a member of a multigene family whose protein products are essential for activation of the myosin ATPase. In the adult, the MLC1s/1c isoform is expressed in both cardiac and slow-twitch skeletal muscles, while it is expressed by all skeletal muscles during development.^ To elucidate the molecular mechanisms that underlie the transcriptional regulation of MLC1s/1c gene expression, the immediate 5$\sp\prime$ flanking region of the gene was isolated and shown to be capable of directing reporter gene expression. Analysis of this region revealed a 110 bp muscle-specific enhancer that includes a myocyte-specific enhancer-binding factor 2 (MEF-2) site, E-boxes, which are potential binding sites for the basic-helix-loop-helix proteins such as MyoD, and a MLC box. The focus of the thesis was to identify the role of the MLC box in expression of the MLC1s/1c gene.^ The MLC box is a member of the family of CArG box containing cis-acting DNA elements. Mutagenesis showed that the MLC box is necessary, but not sufficient, for the expression of a reporter gene linked to the 5$\sp\prime$ flanking region of the MLC1s/1c gene. Linker scanner and site-directed mutagenesis identified a number of potential sites within the 110 bp muscle-specific enhancer that may cooperate with the MLC box. These are the MEF-2 site, the E-box site, and a 10 bp element located upstream of the MEF-2 site that does not have sequence similarity with any known cis-acting element. The MLC box is capable of binding to factors present in muscle nuclear extracts, as well as to human recombinant serum response factor (SRF). Binding of SRF to the MLC box was correlated with the ability of the 5$\sp\prime$ flanking region of the MLC1s/1c gene to drive reporter gene expression. Results suggest a model in which binding of SRF to the MLC box activates expression of the MLC1s/1c gene while binding of the factors present in the nuclear extracts suppresses the expression of the gene. (Abstract shortened with permission of author.) ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

{\it cis\/} -acting determinants in the control of MuSVts110 RNA splicing

Like other simple retroviruses the murine sarcoma virus ts110 (MuSVts110) displays an inefficient mode of genome splicing. But, unlike the splicing phenotypic of other retroviruses, the splicing event effected upon the transcript of MuSVts110 is temperature sensitive. Previous work in this laboratory has established that the conditionally defective nature of MuSVts110 RNA splicing is mediated in cis by features in the viral transcript. Here we show that the 5$\sp\prime$ splice site of the MuSVts110 transcript acts as a point of control of the overall splicing efficiency at both permissive and nonpermissive temperatures for splicing. We strengthened and simultaneously weakened the nucleotide structure of the 5$\sp\prime$ splice site in an attempt to elucidate the differential effects each of the two known critical splicing components which interact with the 5$\sp\prime$ splice site have on the overall efficiency of intron excision. We found that a transversion of the sixth nucleotide, resulting in the formation of a near-consensus 5$\sp\prime$ splice site, dramatically increased the overall efficiency of MuSVts110 RNA splicing and abrogated the thermosensitive nature of this splicing event. Various secondary mutations within this original transversion mutant, designed to selectively decrease specific splicing component interactions, lead to recovery of inefficient and thermosensitive splicing. We have further shown that a sequence of 415 nucleotides lying in the downstream exon of the viral RNA and hypothesized to act as an element in the temperature-dependent inhibition of splicing displays a functional redundancy throughout its length; loss and/or replacement of any one sequence of 100 nucleotides within this sequence does not, with one exception detailed below, diminish the degree to which MuSVts110 RNA is inhibited to splice at the restrictive temperature. One specific deletion, though, fortuitously juxtaposed and activated cryptic consensus splicing signals for the excision of a cryptic intron within the downstream exon and markedly potentiated--across a newly defined cryptic exon--the splicing event effected upon the upstream, native intron. We have exploited this mutant of MuSVts110 to further an understanding of the process of exon definition and intron definition and show that the polypyrimidine tract and consensus 3$\sp\prime$ splice site, as well as the 5$\sp\prime$ splice site, within the intron at the 3$\sp\prime$ flank of the defined exon are required for the exon's definition; implying that definition of the downstream intron is required for the in vivo definition of the proximal, upstream exon. Finally; we have shown, through the construction of heterologous mutants of MuSVts110 employing a foreign 3$\sp\prime$ end-forming sequence, that efficiency of transcript splicing can be increased--to a degree which abrogates its thermosensitive nature--in direct proportion to increasing proximity of the 3$\sp\prime$ end-forming signal to the terminal 3$\sp\prime$ splice site. ^

Transcriptional regulation of the human {\it PAX6\/} gene

PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^

MULTIPLE POSTTRANSCRIPTIONAL REGULATORY FEATURES CONTROL EXPRESSION OF ETHANOLAMINE UTILIZATION GENES IN ENTEROCOCCUS FAECALIS

Enterococcus faecalis is a Gram-positive bacterium that lives as a commensal organism in the mammalian gastrointestinal tract, but can behave as an opportunistic pathogen. Our lab discovered that mutation of the eutK gene attenuates virulence of E. faecalis in the C. elegans model host. eutK is part of the ethanolamine metabolic pathway which was previously unknown in E. faecalis. I discovered the presence of two unique posttranscriptional regulatory features that control expression of eut locus genes. The first feature I found is an AdoCBL riboswitch, a cis-acting RNA regulatory element that acts as a positive regulator of gene expression. The second feature I discovered is a unique two-component system, EutVW. The EutV response regulator contains an ANTAR family domain, which binds RNA to trigger transcriptional antitermination. I determined that induction of expression of several genes in the eut locus is dependent on ethanolamine, AdoCBL and the two-component system. AdoCBL and ethanolamine are both required for induction of eut locus gene expression. Additionally, I discovered eutG is regulated by a unique mechanism of antitermination. Both the AdoCBL riboswitch and EutV response regulator control the expression of the downstream gene eutG. EutV potentially acts through a novel antitermination mechanism in which a dimer of EutV binds to a pair of mRNA stem loops forming an antitermination complex. My data show a unique mechanism by which two environmental signals are integrated by two different posttranscriptional regulators to regulate a single locus.

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Transcriptional regulation of the invariant chain associated with MHC class II molecules

The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^

Transcriptional regulation of the chicken MLC3f gene

The expression of the chicken fast skeletal myosin alkali light chain (MLC) 3f is subject to complex patterns of control by developmental and physiologic signals. Regulation over MLC3f gene expression is thought to be exerted primarily at the transcriptional level. The purpose of this dissertation was to identify cis-acting elements on the 5$\sp\prime$ flanking region of chicken MLC3f gene that are important for transcriptional regulation. The results show that the 5$\sp\prime$ flanking region of MLC3f gene contains multiple cis-acting elements. The nucleotide sequence of these elements demonstrates a high degree of conservation between different species and are also found in the 5$\sp\prime$ flanking regions of many muscle protein genes. The first regulatory region is located between $-$185 and $-$150 bp from the transcription start site and contains an AT-rich element. Linker scanner analyses have revealed that this element has a positive effect on transcription of the MLC3f promoter. Furthermore, when linked to a heterologous viral promoter, it can enhance reporter gene expression in a muscle-specific manner, independent of distance or orientation.^ The second regulatory region is located between $-$96 and $-$64 from the transcription start site. Sequences downstream of $-$96 have the capacity to drive muscle-specific reporter gene expression, although the region between $-$96 and $-$64 has no intrinsic enhancer-like activity. Linker scanner analyses have identified a GC-rich motif that required efficient transcription of the MLC3f promoter. Mutations to this region of DNA results in diminished capacity to drive reporter gene expression and is correlated with disruption of the ability to bind sequence-specific transcription factors. These sequence-specific DNA-binding proteins were detected in both muscle and non-muscle extracts. The results suggest that the mere presence or absence of transcription factors cannot be solely responsible for regulation of MLC3f expression and that tissue-specific expression may arise from complex interactions with muscle-specific, as well as more ubiquitous transcription factors with multiple regulatory elements on the gene. ^

Regulatory factors and control of anthrax toxin gene expression

Bacillus anthracis plasmid pXO1 carries genes for three anthrax toxin proteins, pag (protective antigen), cya (edema factor), and lef (lethal factor). Expression of the toxin genes is enhanced by two signals: CO$\sb2$/bicarbonate and temperature. The CO$\sb2$/bicarbonate effect requires the presence of pXO1. I hypothesized that pXO1 harbors a trans-acting regulatory gene(s) required for CO$\sb2$/bicarbonate-enhanced expression of the toxin genes. Characterization of such a gene(s) will lead to increased understanding of the mechanisms by which B. anthracis senses and responds to host environments.^ A regulatory gene (atxA) on pXO1 was identified. Transcription of all three toxin genes is decreased in an atxA-null mutant. There are two transcriptional start sites for pag. Transcription from the major site, P1, is enhanced in elevated CO$\sb2$. Only P1 transcripts are significantly decreased in the atxA mutant. Deletion analysis of the pag upstream region indicates that the 111-bp region upstream of the P1 site is sufficient for atxA-mediated increase of this transcript. The cya and lef genes each have one apparent transcriptional start site. The cya and lef transcripts are significantly decreased in the atxA mutant. The atxA mutant is avirulent in mice. The antibody response to all three toxin proteins is significantly decreased in atxA mutant-infected mice. These data suggest that the atxA gene product activates expression of the toxin genes and is essential for virulence.^ Since expression of the toxin genes is dependent on atxA, whether increased toxin gene expression in response to CO$\sb2$/bicarbonate and temperature is associated with increased atxA expression was investigated. I monitored steady state levels of atxA mRNA and AtxA protein in different growth conditions. The results indicate that expression of atxA is not influenced by CO$\sb2$/bicarbonate. Steady state levels of atxA mRNA and AtxA protein are higher at 37$\sp\circ$C than 28$\sp\circ$C. However, increased pag expression at high temperature can not be attributed directly to increased atxA expression.^ There is evidence that an additional factor(s) may be involved in regulation of pag. Expression of pag in strains overproducing AtxA is significantly decreased compared to the wildtype strain. A specific interaction of tagged-AtxA with the pag upstream DNA has not been demonstrated. Furthermore, four proteins in B. anthracis extract can be co-immunoprecipitated with tagged-AtxA. Amino-terminal sequence of one protein has been determined and found highly homologous to chaperonins of GroEL family. Studies are under way to determine if this GroEL-like protein interactions with AtxA and plays any role in atxA-mediated activation of toxin genes. ^

Function and regulation of anionic phospholipids in mitochondria of Saccharomyces cerevisiae

As the major anionic phospholipids predominantly found in the mitochondrial inner membrane of eukaryotic cells, cardiolipin (CL) and its precursor phosphatidylglycerol (PG) are of great importance in many critical mitochondrial processes. Pgs1Δ cells of Saccharomyces cerevisiae lacking both PG and CL display severe mitochondrial defects. Translation of several proteins including products of four mitochondrial DNA (mtDNA) encoded genes (COX1, COX2, COX3, and COB ) and one nuclear-encoded gene (COX4) is inhibited. The molecular basis of this phenotype was analyzed using a combined biochemical, molecular and genetic approach. ^ Using a mitochondrial targeted green fluorescence protein (mtGFP) fused to the COX4 promoter and its 5′ and 3′ untranslated regions (UTRs), lack of mtGFP expression independent of carbon source and strain background was confirmed to be at the translational level. The translational defect was not due to deficiency of mitochondrial respiratory function but rather caused directly by the lack of PG/CL in the mitochondrial membrane. Re-introduction of a functional PGS1 gene restored PG synthesis and expression of the above mtGFP. Deletional analysis of the 5′ UTR of COX4 mRNA revealed the presence of a 50 nt sequence as a cis-acting element inhibiting COX4 translation. Using similar constructs with HIS3 and lacZ as reporter genes, extragenic spontaneous mutations that allowed expression of His3p and β-galactosidase were isolated, which appeared to be recessive and derived from loss-of-function mutations as determined by mating analysis. Using a tetracycline repressible plasmid-borne PGS1 expression system and an in vivo mitochondrial protein translation method, the translation of mtDNA encoded COX1 and COX3 mRNAs was shown to be significantly inhibited in parallel with reduced levels of PG/CL content. Therefore, the cytoplasmic translation machinery appears to be able to sense the level of PG/CL in mitochondria and regulate COX4 translation coordinately with the mtDNA encoded subunits. ^ The essential requirement of PG and CL in mitochondrial function was further demonstrated in the study of CL synthesis by factors affecting mitochondrial biogenesis such as carbon source, growth phase or mitochondrial mutations at the level of transcription. We have also demonstrated that CL synthesis is dependent on the level of PG and INO2/INO4 regulatory genes. ^

Regulation of mucin gene expression by CREB via a nonclassical retinoic acid signaling pathway.

Vitamin A and its metabolite retinoic acid (RA) are essential elements for normal lung development and the differentiation of lung epithelial cells. We previously showed that RA rapidly activated cyclic AMP response element-binding protein (CREB) in a nonclassical manner in normal human tracheobronchial epithelial (NHTBE) cells. In the present study, we further demonstrated that this nonclassical signaling of RA on the activation of CREB plays a critical role in regulating the expression of airway epithelial cell differentiation markers, the MUC2, MUC5AC, and MUC5B genes. We found that RA rapidly activates the protein kinase Calpha isozyme and transmits the activation signal to CREB via the Raf/MEK/extracellular signal-regulated kinase/p90 ribosomal S6 kinase (RSK) pathway. Activated RSK translocated from the cytoplasm to the nucleus, where it phosphorylates CREB. Activated CREB then binds to a cis-acting replication element motif on the promoter (at nucleotides [nt] -878 to -871) of the MUC5AC gene. The depletion of CREB using small interfering RNA abolished not only the RA-induced MUC5AC but also RA-induced MUC2 and MUC5B. Taken together, our findings demonstrate that CREB activation via this nonclassical RA signaling pathway may play an important role in regulating the expression of mucin genes and mediating the early biological effects of RA during normal mucous differentiation in NHTBE cells.

Mutations affecting beta-tubulin folding and degradation.

Revertants of a colcemid-resistant Chinese hamster ovary cell line with an altered (D45Y) beta-tubulin have allowed the identification of four cis-acting mutations (L187R, Y398C, a 12-amino acid in-frame deletion, and a C-terminal truncation) that act by destabilizing the mutant tubulin and preventing it from incorporating into microtubules. These unstable beta-tubulins fail to form heterodimers and are predominantly found in association with the chaperonin CCT, suggesting that they cannot undergo productive folding. In agreement with these in vivo observations, we show that the defective beta-tubulins do not stably interact with cofactors involved in the tubulin folding pathway and, hence, fail to exchange with beta-tubulin in purified alphabeta heterodimers. Treatment of cells with MG132 causes an accumulation of the aberrant tubulins, indicating that improperly folded beta-tubulin is degraded by the proteasome. Rapid degradation of the mutant tubulin does not elicit compensatory changes in wild-type tubulin synthesis or assembly. Instead, loss of beta-tubulin from the mutant allele causes a 30-40% decrease in cellular tubulin content with no obvious effect on cell growth or survival.