98 resultados para mouse lymphoma cells


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A fundamental task in developmental biology is to understand the molecular mechanisms governing early embryogenesis. The aim of this study was to understand the developmental role of a putative basic helix-loop-helix (b-HLH) transcription factor, twist, during mouse embryogenesis.^ twist was originally identified in Drosophila as one of the zygotic genes, including snail, that were required for dorsal-ventral patterning. In Drosophila embryogenesis, twist is expressed in the cells of the ventral midline destined to form mesoderm. In embryos lacking twist expression, their ventral cells fail to form a ventral furrow and subsequently no mesoderm is formed.^ During mouse embryogenesis, twist is expressed after initial mesoderm formation in both mesoderm and cranial neural crest cell derivatives. To study the role of twist in vivo, twist-null embryos were generated by gene targeting. Embryos homozygous for the twist mutation die at midgestation. The most prominent phenotype in the present study was a failure of the cranial neural tube to close (exencephaly). twist-null embryos also showed defects in head mesenchyme, branchial arches, somites, and limb buds.^ To understand whether twist functions cell-autonomously and to investigate how twist-null cells interact with wild-type cells in vivo, twist chimeras composed of both twist-null and wild-type cells marked by the expression of the lacZgene were generated. Chimeric analysis revealed a correlation between the incidence of exencephaly and the contribution of the underlying twist-null head mesenchyme, thus strongly suggesting that twist-expressing head mesenchyme is required for the closure of the cranial neural tube. These studies have identified twist as a critical regulator for the mesenchymal fate determination within the cranial neural crest lineage. Most strikingly, twist-null head mesenchyme cells were always segregated from wild-type cells, indicating that the twist mutation altered the adhesive specificity of these cells. Furthermore, these results also indicated that twist functions cell-autonomously in the head, arch, and limb mesenchyme but non-cell-autonomously in the somites. Taken together, these studies have established the essential role of twist during mouse embryogenesis. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Single-locus mutations in mice can express epileptic phenotypes and provide critical insights into the naturally occurring defects that alter excitability and mediate synchronization in the central nervous system (CNS). One such recessive mutation (on chromosome (Chr) 15), stargazer(stg/stg) expresses frequent bilateral 6-7 cycles per second (c/sec) spike-wave seizures associated with behavioral arrest, and provides a valuable opportunity to examine the inherited lesion associated with spike-wave synchronization.^ The existence of distinct and heterogeneous defects mediating spike-wave discharge (SWD) generation has been demonstrated by the presence of multiple genetic loci expressing generalized spike-wave activity and the differential effects of pharmacological agents on SWDs in different spike-wave epilepsy models. Attempts at understanding the different basic mechanisms underlying spike-wave synchronization have focused on $\gamma$-aminobutyric acid (GABA) receptor-, low threshold T-type Ca$\sp{2+}$ channel-, and N-methyl-D-aspartate receptor (NMDA-R)-mediated transmission. It is believed that defects in these modes of transmission can mediate the conversion of normal oscillations in a trisynaptic circuit, which includes the neocortex, reticular nucleus and thalamus, into spike-wave activity. However, the underlying lesions involved in spike-wave synchronization have not been clearly identified.^ The purpose of this research project was to locate and characterize a distinct neuronal hyperexcitability defect favoring spike-wave synchronization in the stargazer brain. One experimental approach for anatomically locating areas of synchronization and hyperexcitability involved an attempt to map patterns of hypersynchronous activity with antibodies to activity-induced proteins.^ A second approach to characterizing the neuronal defect involved examining the neuronal responses in the mutant following application of pharmacological agents with well known sites of action.^ In order to test the hypothesis that an NMDA receptor mediated hyperexcitability defect exists in stargazer neocortex, extracellular field recordings were used to examine the effects of CPP and MK-801 on coronal neocortical brain slices of stargazer and wild type perfused with 0 Mg$\sp{2+}$ artificial cerebral spinal fluid (aCSF).^ To study how NMDA receptor antagonists might promote increased excitability in stargazer neocortex, two basic hypotheses were tested: (1) NMDA receptor antagonists directly activate deep layer principal pyramidal cells in the neocortex of stargazer, presumably by opening NMDA receptor channels altered by the stg mutation; and (2) NMDA receptor antagonists disinhibit the neocortical network by blocking recurrent excitatory synaptic inputs onto inhibitory interneurons in the deep layers of stargazer neocortex.^ In order to test whether CPP might disinhibit the 0 Mg$\sp{2+}$ bursting network in the mutant by acting on inhibitory interneurons, the inhibitory inputs were pharmacologically removed by application of GABA receptor antagonists to the cortical network, and the effects of CPP under 0 Mg$\sp{2+}$aCSF perfusion in layer V of stg/stg were then compared with those found in +/+ neocortex using in vitro extracellular field recordings. (Abstract shortened by UMI.) ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

HER-2/neu is a receptor tyrosine kinase highly homologous with epidermal growth factor receptor. Overexpression and/or amplification of HER-2/neu has been implicated in the genesis of a number of human cancers, especially breast and ovarian cancers. Transcriptional upregulation has been shown to contribute significantly to the overexpression of this gene. Studies on the transcriptional regulation of HER-2/neu gene are important for understanding the mechanism of cell transformation and developing the therapeutic strategies to block HER-2/neu-mediated cancers. PEA3 is a DNA binding transcriptional factor and its consensus sequence exists on the HER-2/neu promoter. To examine the role of PEA3 in HER-2/neu expression and cell transformation, we transfected PEA3 into the human breast and ovarian cancer cells that overexpress HER-2/neu and showed that PEA3 dramatically represses HER-2/neu transcription. PEA3 suppresses the oncogenic neu-mediated transformation in mouse fibroblast NIH 3T3 cells. Expression of PEA3 selectively blocks the growth of human cancer cells that overexpress HER-2/neu and inhibits their colony formation. It does not occur in the cancer cells expressing basal level of HER-2/neu. Further studies in the orthotopic ovarian cancer model demonstrated that expression of PEA3 preferentially inhibits growth and tumor development of human cancer cells that overexpress HER-2/neu, the tumor-bearing mice survived significantly longer if treated by injection of the PEA3-liposome complex intraperitoneally. Immunoblotting and immunohistochemical analysis of the tumor tissues indicated that PEA3 mediates the tumor suppression activity through targeting HER-2/neu-p185. Thus, PEA3 is a negative regulator of HER-2/neu gene expression and functions as a tumor suppressor gene in the HER-2/neu-overexpressing human cancer cells.^ The molecular mechanisms of PEA3 mediated transcriptional repression were investigated. PEA3 binds specifically at the PEA3 site on HER-2/neu promoter and this promoter-binding is required for the PEA3 mediated transcriptional repression. Mutation of the PEA3 binding site on HER-2/neu promoter causes decreased transcriptional activity, indicating that the PEA3 binding site is an enhancer-like element in the HER-2/neu-overexpressing cells. We therefore hypothesized that in the HER-2/neu-overexpressing cells, PEA3 competes with a transactivator for binding to the PEA3 site, preventing the putative factor from activating the transcription of HER-2/neu. This hypothesis was supported by the data which demonstrate that PEA3 competes with another nuclear protein for binding to the HER-2/neu promoter in vitro, and expression of a truncated protein which encodes the DNA binding domain of PEA3 is sufficient to repress HER-2/neu transcription in the HER-2/neu-overexpressing human cancer cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mutations in the p53 tumor suppressor gene are found in over 50% of human tumors and in the germline of Li-Fraumeni syndrome families. About 80% of these mutations are missense in nature. In order to study how p53 missense mutations affect tumorigenesis in vivo, we focused on the murine p53 arg-to-his mutation at amino acid 172, which corresponds to the human hot spot mutation at amino acid 175. The double replacement procedure was employed to introduce the p53 R172H mutation into the p53 locus of ES cells and mice were generated. An additional 1bp deletion in the intron 2 splice acceptor site was detected in the same allele in mice. We named this allele p53R172HΔg. This allele makes a small amount of full length p53 mutant protein. ^ Spontaneous tumor formation and survival were studied in these mice. Mice heterozygous for the p53R172HΔg allele showed 50% survival at 17 months of age, similar to the p53+/− mice. Moreover, the p53R172HΔg/+ mice showed a distinct tumor spectrum: 55% sarcomas, including osteosarcoms, fibrosarcomas and angiosarcomas; 27% carcinomas, including lung adenocarcinomas, squamous cell carcinomas, hepatocellular carcinomas and islet cell carcinomas; and 18% lymphomas. Compared to the p53+/− mice, there was a clear increase in the frequency of carcinoma development and a decrease in lymphoma incidence. Among the sarcomas that developed, fibrosarcomas in the skin were also more frequently observed. More importantly, osteosarcomas and carinomas that developed in the p53R172HΔg/+ mice metastasized at very high frequency (64% and 67%, respectively) compared with less than 10% in the p53+/− mice. The metastatic lesions were usually found in lung and liver, and less frequently in other tissues. The altered tumor spectrum in the mice and increased metastatic potential of the tumors suggested that the p53R172H mutation represents a gain-of-function. ^ Mouse embryonic fibroblasts (MEFs) from the mice homozygous and heterozygous for the p53R172HΔg allele were studied for growth characteristics, immortalization potential and genomic instability. All of the p53R172HΔg /+ MEF lines are immortalized under a 3T3 protocol while under the same protocol p53+/− MEFs are not immortalized. Karyotype analysis showed a persistent appearance of chromosome end-to-end fusion in the MEFs both homozygous and heterozygous for the p53R172HΔg allele. These observations suggest that increased genomic instability in the cells may cause the altered tumor phenotypes. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Despite multiple changes in the adjuvant chemotherapy regimens used to treat osteosarcoma (OS), the 2-year metastasis-free survival has remained at 65–70% for the past 10 years. Characterizing the molecular determinants that permit metastatic spread of tumor cells is a crucial element in developing new approaches for the treatment of osteosarcoma. Since OS metastasizes almost exclusively to the lung, an organ with constitutive Fas ligand (FasL) expression, we hypothesized that the expression of Fas (CD95, APO-1) by OS cells may play a role in the ability of these cells to form lung metastases. Fas expression was quantified in human SAOS-2 OS cells and selected variants (LM2, LM4, LM5, LM6, LM7). Using northern blot, FACS and RT-PCR analysis, low Fas expression was found to correlate with higher metastatic potential in these cell lines. The highly metastatic LM7 cell line was transfected with the full-length human Fas gene and injected into athymic nude mice. The median number of metastatic nodules per mouse fell from over 200 to 1.1 and the size of the nodules decreased from a range of 0.5–9.0 mm to less than 0.5 mm in the Fas-transfected cell line compared to the native LM7 cell line. Additionally, the subsequent incidence of lung metastases was lower in the Fas-expressing cell line. IL-12 was seen to upregulate Fas expression in the highly metastatic LM sublines in vitro. To visualize the effects of IL-12 in vivo, nude mice were injected with LM7 cells and treated biweekly for 4 weeks with Ad.mIL-12, saline control or Ad.βgal. Lung sections were analyzed via immunchistochemistry for Fas expression. A higher expression of Fas was found in tumors from mice receiving IL-12. To study the mechanism by which IL-12 upregulates Fas, LM7 cells were transfected with a luciferase reporter gene construct containing the full-length human fas promoter. Treatment with IL-12 increased luciferase activity. We therefore conclude that IL-12 influences the metastatic potential of OS cells by upregulating the fas promoter, resulting in increased cell surface Fas expression and susceptibility to Fas-induced cell death. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aberrant activation of signal transduction pathways has long been linked to uncontrolled cell proliferation and the development of cancer. The activity of one such signaling module, the Mitogen-Activated Protein Kinase (MAPK) pathway, has been implicated in several cancer types including pancreatic, breast, colon, and lymphoid malignancies. Interestingly, the activation of MAP-Kinase-Kinase-Kinase proteins often leads to the additional activation of NF-κB, a transcription factor that acts as a cell survival signal through its control of antiapoptotic genes. We have investigated the role of a specific dimer form of the NF-κB transcription factor family, NF-κB1 (p50) homodimers, in its control of the proto-oncogene, Bcl-2, and we have identified the MEK/ERK (MAPK) signaling cascade as a mediator of NF-κB1 activity. ^ Two murine B cell lymphoma cell lines were used for these studies: LY-as, an apoptosis proficient line with low Bcl-2 protein expression and no nuclear NF-κB activity, and LY-ar, a nonapoptotic line with constitutive p50 homodimer activity and 30 times more Bcl-2 protein expression than LY-as. Experiments modulating p50 activity correlated the activation of p50 homodimers with Bcl-2 expression and additional gel shift experiments demonstrated that the Bcl-2 P1 promoter had NF-κB sites with which recombinant p50 was able to interact. In vitro transcription revealed that p50 enhanced the production of transcripts derived from the Bcl-2 P1 promoter. These data strongly suggest that Bcl-2 is a target gene for p50-mediated transcription and suggest that the activation of p50 homodimers contributes to the expression of Bcl-2 observed in LY-ar cells. ^ Studies of upstream MAPK pathways that could influence NF-κB activity demonstrated that LY-ar cells had phosphorylated ERK proteins while LY-as cells did not. Treatment of LY-ar cells with the MEK inhibitors PD 98059, U0126, and PD 184352 led to a loss of phosphorylated ERK, a reversal of nuclear p50 homodimer DNA binding, and a decrease in the amount of Bcl-2 protein expression. Similarly, the activation of the MEK/ERK pathway in LY-as cells by phorbol ester led to Bcl-2 expression that could be blocked by PD 98059. Furthermore, treatment of LY-ar cells with TNFα, an IKK activator, did not change the suppressive effect of PD 98059 on p50 homodimer activity, suggesting an IKK-independent pathway for p50 homodimer activation. Lastly, all three MEK inhibitors sensitized LY-ar cells to radiation-induced apoptosis. ^ These data indicate that the activation of the MEK/ERK MAP-Kinase signaling pathway acts upstream of p50 homodimer activation and Bcl-2 expression in this B cell lymphoma cell system and suggest that the activation of MEK/ERK may be a key step in the progression of lymphoma to advanced-staged disease. Other researchers have used MEK inhibitors to inhibit cell growth and sensitize a number of tumors to chemotherapies. In light of our data, MEK inhibitors may additionally be useful clinically to radiosensitize cancers of lymphoid origin. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Missense mutations in the p53 tumor-suppressor gene are the most common alterations of p53 in somatic tumors and in patients with Li-Fraumeni syndrome. p53 missense mutations occur in the DNA binding region and disrupt the ability of p53 to activate transcription. In vitro studies have shown that some p53 missense mutants have a gain-of-function or dominant-negative activity. ^ The p53 175 Arg-to-His (p53 R175H) mutation in humans has been shown to have dominant-negative and gain-of-function properties in vitro. This mutation is observed in the germline of individuals with Li-Fraumeni syndrome. To accurately model Li-Fraumeni syndrome and to examine the mechanistic nature of a gain-of-function missense mutation on in vivo tumorigenesis, we generated and characterized a mouse with the corresponding mutation, p53 R172H. p53R172H homozygous and heterozygous mice developed similar tumor spectra and survival curves as p53 −/− and p53+/− mice, respectively. However, tumors in p53+/R172H mice metastasized to various organs with high frequency, suggesting a gain-of-function phenotype by p53R172H in vivo. Mouse embryonic fibroblasts (MEFs) from p53R172H mice also showed gain-of-function phenotypes in cell proliferation, DNA synthesis, and transformation potential, while cells from p53+/− and p53−/− mice did not. ^ To mechanistically characterize the gain-of-function phenotype of the p53R172H mutant, the role of p53 family members, p63 and p73, was analyzed. Disruption of p63 and p73 by siRNAs in p53 −/− MEFs increased transformation potential and reinitiated DNA synthesis to levels observed in p53R172H/R172H cells. Additionally, p63 and p73 were bound and functionally inactivated by p53R172H in metastatic p53 R172H tumor-derived cell lines, indicating a role for the p53 family members in the gain-of-function phenotype. This study provides in vivo evidence for the gain-of-function effect of p53 missense mutations and more accurately models the Li-Fraumeni syndrome. ^