79 resultados para Mouse uterus
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
A fundamental task in developmental biology is to understand the molecular mechanisms governing early embryogenesis. The aim of this study was to understand the developmental role of a putative basic helix-loop-helix (b-HLH) transcription factor, twist, during mouse embryogenesis.^ twist was originally identified in Drosophila as one of the zygotic genes, including snail, that were required for dorsal-ventral patterning. In Drosophila embryogenesis, twist is expressed in the cells of the ventral midline destined to form mesoderm. In embryos lacking twist expression, their ventral cells fail to form a ventral furrow and subsequently no mesoderm is formed.^ During mouse embryogenesis, twist is expressed after initial mesoderm formation in both mesoderm and cranial neural crest cell derivatives. To study the role of twist in vivo, twist-null embryos were generated by gene targeting. Embryos homozygous for the twist mutation die at midgestation. The most prominent phenotype in the present study was a failure of the cranial neural tube to close (exencephaly). twist-null embryos also showed defects in head mesenchyme, branchial arches, somites, and limb buds.^ To understand whether twist functions cell-autonomously and to investigate how twist-null cells interact with wild-type cells in vivo, twist chimeras composed of both twist-null and wild-type cells marked by the expression of the lacZgene were generated. Chimeric analysis revealed a correlation between the incidence of exencephaly and the contribution of the underlying twist-null head mesenchyme, thus strongly suggesting that twist-expressing head mesenchyme is required for the closure of the cranial neural tube. These studies have identified twist as a critical regulator for the mesenchymal fate determination within the cranial neural crest lineage. Most strikingly, twist-null head mesenchyme cells were always segregated from wild-type cells, indicating that the twist mutation altered the adhesive specificity of these cells. Furthermore, these results also indicated that twist functions cell-autonomously in the head, arch, and limb mesenchyme but non-cell-autonomously in the somites. Taken together, these studies have established the essential role of twist during mouse embryogenesis. ^
Neocortical hyperexcitability defect in a mutant mouse model of spike-wave epilepsy, {\it stargazer}
Resumo:
Single-locus mutations in mice can express epileptic phenotypes and provide critical insights into the naturally occurring defects that alter excitability and mediate synchronization in the central nervous system (CNS). One such recessive mutation (on chromosome (Chr) 15), stargazer(stg/stg) expresses frequent bilateral 6-7 cycles per second (c/sec) spike-wave seizures associated with behavioral arrest, and provides a valuable opportunity to examine the inherited lesion associated with spike-wave synchronization.^ The existence of distinct and heterogeneous defects mediating spike-wave discharge (SWD) generation has been demonstrated by the presence of multiple genetic loci expressing generalized spike-wave activity and the differential effects of pharmacological agents on SWDs in different spike-wave epilepsy models. Attempts at understanding the different basic mechanisms underlying spike-wave synchronization have focused on $\gamma$-aminobutyric acid (GABA) receptor-, low threshold T-type Ca$\sp{2+}$ channel-, and N-methyl-D-aspartate receptor (NMDA-R)-mediated transmission. It is believed that defects in these modes of transmission can mediate the conversion of normal oscillations in a trisynaptic circuit, which includes the neocortex, reticular nucleus and thalamus, into spike-wave activity. However, the underlying lesions involved in spike-wave synchronization have not been clearly identified.^ The purpose of this research project was to locate and characterize a distinct neuronal hyperexcitability defect favoring spike-wave synchronization in the stargazer brain. One experimental approach for anatomically locating areas of synchronization and hyperexcitability involved an attempt to map patterns of hypersynchronous activity with antibodies to activity-induced proteins.^ A second approach to characterizing the neuronal defect involved examining the neuronal responses in the mutant following application of pharmacological agents with well known sites of action.^ In order to test the hypothesis that an NMDA receptor mediated hyperexcitability defect exists in stargazer neocortex, extracellular field recordings were used to examine the effects of CPP and MK-801 on coronal neocortical brain slices of stargazer and wild type perfused with 0 Mg$\sp{2+}$ artificial cerebral spinal fluid (aCSF).^ To study how NMDA receptor antagonists might promote increased excitability in stargazer neocortex, two basic hypotheses were tested: (1) NMDA receptor antagonists directly activate deep layer principal pyramidal cells in the neocortex of stargazer, presumably by opening NMDA receptor channels altered by the stg mutation; and (2) NMDA receptor antagonists disinhibit the neocortical network by blocking recurrent excitatory synaptic inputs onto inhibitory interneurons in the deep layers of stargazer neocortex.^ In order to test whether CPP might disinhibit the 0 Mg$\sp{2+}$ bursting network in the mutant by acting on inhibitory interneurons, the inhibitory inputs were pharmacologically removed by application of GABA receptor antagonists to the cortical network, and the effects of CPP under 0 Mg$\sp{2+}$aCSF perfusion in layer V of stg/stg were then compared with those found in +/+ neocortex using in vitro extracellular field recordings. (Abstract shortened by UMI.) ^
Resumo:
Missense mutations in the p53 tumor-suppressor gene are the most common alterations of p53 in somatic tumors and in patients with Li-Fraumeni syndrome. p53 missense mutations occur in the DNA binding region and disrupt the ability of p53 to activate transcription. In vitro studies have shown that some p53 missense mutants have a gain-of-function or dominant-negative activity. ^ The p53 175 Arg-to-His (p53 R175H) mutation in humans has been shown to have dominant-negative and gain-of-function properties in vitro. This mutation is observed in the germline of individuals with Li-Fraumeni syndrome. To accurately model Li-Fraumeni syndrome and to examine the mechanistic nature of a gain-of-function missense mutation on in vivo tumorigenesis, we generated and characterized a mouse with the corresponding mutation, p53 R172H. p53R172H homozygous and heterozygous mice developed similar tumor spectra and survival curves as p53 −/− and p53+/− mice, respectively. However, tumors in p53+/R172H mice metastasized to various organs with high frequency, suggesting a gain-of-function phenotype by p53R172H in vivo. Mouse embryonic fibroblasts (MEFs) from p53R172H mice also showed gain-of-function phenotypes in cell proliferation, DNA synthesis, and transformation potential, while cells from p53+/− and p53−/− mice did not. ^ To mechanistically characterize the gain-of-function phenotype of the p53R172H mutant, the role of p53 family members, p63 and p73, was analyzed. Disruption of p63 and p73 by siRNAs in p53 −/− MEFs increased transformation potential and reinitiated DNA synthesis to levels observed in p53R172H/R172H cells. Additionally, p63 and p73 were bound and functionally inactivated by p53R172H in metastatic p53 R172H tumor-derived cell lines, indicating a role for the p53 family members in the gain-of-function phenotype. This study provides in vivo evidence for the gain-of-function effect of p53 missense mutations and more accurately models the Li-Fraumeni syndrome. ^