Regulation of {\it neu\/} gene expression by the simian virus 40 large T antigen and tumor suppressors Rb and p53

The neu gene (also c-erbB-2 or HER2) encodes a 185 kilodalton protein that is frequently overexpressed in breast, ovarian and non-small cell lung cancers. Study of the regulation of neu indicates that neu gene expression can be modulated by c-myc or by the adenovirus 5 E1a gene product. This study demonstrates that the transforming protein, large T antigen, of the simian virus 40 represses neu promoter activity. Repression of neu by large T antigen is mediated through the region $-$172 to $-$79 (relative to first ATG) of the neu promoter--unlike through $-$312 to $-$172 for c-myc or E1a. This suggests a different pathway for repression of neu by large T antigen. The 10 amino acid region of large T required for binding the tumor suppressor, retinoblastoma gene product, Rb, is not necessary for repression of neu. Moreover, the tumor suppressors, Rb and p53 can independently inhibit neu promoter activity. Rb inhibits neu through a 10 base pair G-rich enhancer (GTG element) ($-$243 to $-$234) and also through regions close to transcription initiation sites ($-$172 to $-$79). Mutant Rb unable to complex large T is able to repress the region close to transcription initiation but not the GTG enhancer. Thus, Rb inhibits the two regulatory domains of the neu gene by different mechanisms. Both Rb and p53 can repress the transforming activity of activated neu in focus forming assays. These data provide evidence that tumor suppressors regulate expression of growth stimulatory genes such as neu. Therefore, one reason for the overexpression of neu that is frequently seen in breast cancer cells may be due to functional inactivation of Rb and p53 which is also a common occurrence in breast cancer cells. ^

Regulation of the {\it neu\/} oncogene by the GTG element binding proteins

A previous study in our lab has shown that the transforming neu oncogene ($neu\sp\*$) was able to initiate signals that lead to repression of the neu promoter activity. Further deletion mapping of the neu promoter identified that the GTG element (GGTGGGGGGG), located between $-$243 and $-$234 relative to the translation initiation codon, mediates such a repression effect. I have characterized the four major protein complexes that interact with this GTG element. In situ UV-crosslinking indicated that each complex contains proteins of different molecular weights. The slowest migrating complex (S) contain Sp1 or Sp1-related proteins, as indicated by the data that both have similar molecular weights, similar properties in two affinity chromatographies, and both are antigenically related in gel shift analysis. Methylation protection and interference experiments demonstrated these complexes bind to overlapping regions of the GTG element. Mutations within the GTG element that either abrogate or enhance complex S binding conferred on the neu promoter with lower activity, indicating that positive factors other than Sp1 family proteins also contribute to neu promoter activity. A mutated version (mutant 4) of the GTG element, which binds mainly the fastest migrating complex that contains a very small protein of 26-kDa, can repress transcription when fused to a heterologous promoter. Further deletion and mutation studies suggested that this GTG mutant and its binding protein(s) may cooperate with some DNA element within a heterologous promoter to lock the basal transcription machinery; such a repressor might also repress neu transcription by interfering with the DNA binding of other transactivators. Our results suggest that both positive and negative trans-acting factors converge their binding sites on the GTG element and confer combinatorial control on the neu gene expression. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Creation of a retinoblastoma mutant with dominant -negative activity

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

Transcriptional regulation of the rat {\it mdr1b\/} gene

The expression of P-glycoproteins encoded by the mdr gene family is associated with the emergence of multidrug-resistance phenotype in animal cells. This gene family includes two members, MDR1 and MDR2, in humans, and three members, mdr1a, mdr1b, and mdr2, in rodents. Among them, the rat mdr1b is known to be highly activated during hepatocarcinogenesis, and its expression is sensitive to the treatment with growth factors, cytotoxic drugs, as well as other physical or chemical stresses. It is believed that the transcriptional regulation plays an important role in above events, however little has been known about mechanisms involved.^ To elucidate how mdr1b expression is regulated, we isolated the genomic sequence of the rat mdr1b and functionally dissected its 5$\prime$ promoter region. Our results demonstrated that: (1) the transcription start site of the rat mdr1b is identical to that of the murine mdr1b homologue; (2) a palindromic sequence from bp $-$189 to $-$180 bp is essential for the basal promoter function of the rat mdr1b, and binds to a specific protein that appears to be a novel transcription factor implicated in the regulation of the rat mdr1b expression; (3) a NF-$\kappa$B-binding site from bp $-$167 to $-$159 is also involved in the basal promoter function. The p65/p50 subunits of the NF-$\kappa$B and raf-1 kinase are implicated in the insulin-inducible promoter activity of the mdr1b, suggesting the important role of NF-$\kappa$B in the regulation of the mdr1b by growth factors; (4) a p53-binding site from bp $-$199 to $-$180 is not only essential for the basal promoter activity but also responsible for the induction of mdr1b by cytotoxic agents. In addition, we provided evidence showing that endogenous mdr1b expression can be modulated by wild-type p53. On the basis of these findings, a model of transcriptional regulation of the rat mdr1b was proposed. ^

Mechanism of molecular regulation of nuclear -encoded mitochondrial gene expression by electrical stimulation in the cultured neonatal rat cardiac myocytes

To answer the question whether increased energy demand resulting from myocyte hypertrophy and enhanced $\beta$-myosin heavy chain mRNA, contractile protein synthesis and assembly leads to mitochondrial proliferation and differentiation, we set up an electrical stimulation model of cultured neonatal rat cardiac myocytes. We describe, as a result of increased contractile activity, increased mitochondrial profiles, cytochrome oxidase mRNA, and activity, as well as a switch in mitochondrial carnitine palmitoyltransferase-I (CPT-I) from the liver to muscle isoform. We investigate physiological pathways that lead to accumulation of gene transcripts for nuclear encoded mitochondrial proteins in the heart. Cardiomyocytes were stimulated for varying times up to 72 hr in serum-free culture. The mRNA contents for genes associated with transcriptional activation (c-fos, c-jun, junB, nuclear respiratory factor 1 (Nrf-1)), mitochondrial proliferation (cytochrome c (Cyt c), cytochrome oxidase), and mitochondrial differentiation (carnitine palmitonyltransferase I (CPT-I) isoforms) were measured. The results establish a temporal pattern of mRNA induction beginning with c-fos (0.25-3 hr) and followed by c-jun (0.5-3 hr), junB (0.5-6 hr), NRF-1 (1-12 hr), Cyt c (12-72 hr), cytochrome c oxidase (12-72 hr). Induction of the latter was accompanied by a marked decrease in the liver-specific CPT-I mRNA. Electrical stimulation increased c-fos, $\beta$-myosin heavy chain, and Cyt c promoter activities. These increases coincided with a rise in their respective endogenous gene transcripts. NRF-1, cAMP response element (CRE), and Sp-1 site mutations within the Cyt c promoter reduced luciferase expression in both stimulated and nonstimulated myocytes. Mutations in the Nrf-1 and CRE sites inhibited the induction by electrical stimulation or by transfection of c-jun into non-paced cardiac myocytes whereas mutation of the Sp-1 site maintained or increased the fold induction. This is consistent with the appearance of NRF-1 and fos/jun mRNAs prior to that of Cyt c. Overexpression of c-jun by transfection also activates the Nrf-1 and Cyt c mRNA sequentially. Electrical stimulation of cardiac myocytes activates the c-Jun-N-terminal kinase so that the fold-activation of the cyt c promoter is increased by pacing when either c-jun or c-fos/c-jun are cotransfected. We have identified physical association of Nrf-1 protein with the Nrf-1 enhancer element and of c-Jun with the CRE binding sites on the Cyt c promoter. This is the first demonstration that induction of Nrf-1 and c-Jun by pacing of cardiac myocytes directly mediates Cyt c gene expression and mitochondrial proliferation in response to hypertrophic stimuli in the heart.^ Subsequent to gene activation pathways that lead to mitochondrial proliferation, we observed an isoform switch in CPT-I from the liver to muscle mRNA. We have found that the half-life for the muscle CPT-I is not affected by electrical stimulation, but electrical decrease the T1/2 in the liver CPT-I by greater than 50%. This suggests that the liver CPT-I switch to muscle isoform is due to (1) a decrease in T1/2 of liver CPT-I and (2) activation of muscle CPT-Itranscripts by electrical stimulation. (Abstract shortened by UMI.) ^

Signaling pathways in the transcriptional and post-translational regulation of the human glutathione S -transferase P1 gene

The human glutathione S-transferase P1 (GSTP1) protein is an endogenous inhibitor of c-jun N-terminal kinases (JNKs) and an important phase II detoxification enzyme. ^ Recent identification of a cAMP response element (CRE) in the 5 ′-region of the human GSTP1 gene and several putative phosphorylation sites for the Ser/Thr protein kinases, including, cAMP-dependent protein kinases (PKAs), protein kinases C (PKCs), and JNKs in the GSTP1 protein raised the possibility that signaling pathways may play an important role in the transcriptional and post-translational regulation of GSTP1 gene. This study examined (a) whether the signaling pathway mediated by CAMP, via the GSTP1 CRE, is involved in the transcriptional regulation of the GSTP1 gene, (b) whether signaling pathways mediated by the Ser/Thr protein kinases (PKAs, PKCs, and JNKs) induce post-translational modification, viz. phosphorylation of the GSTP1 protein, and (c) whether such phosphorylation of the GSTP1 protein alters its functions in metabolism and in JNK signaling. ^ The first major finding in this study is the establishment of the human GSTP1 gene as a novel CAMP responsive gene in which transcription is activated via an interaction between PKA activated CRE binding protein-1 (CREB-1) and the CRE in the 5′-regulatory region. ^ The second major finding in this study is the observation that the GSTP1 protein undergoes phosphorylation and functionally activated by second messenger-activated protein kinases, PKA and PKC, in tumor cells with activated signaling pathways. Following phosphorylation by PKA or PKC, the catalytic activity of the GSTP1 protein was significantly enhanced, as indicated by a decrease in its Km (2- to 3.6-fold) and an increase in Kcat/ Km (1.6- to 2.5-fold) for glutathione. Given the frequent over-expression of GSTP1 and the aberrant PKA/PKC signaling cascade observed in tumors, these findings suggest that phosphorylation of GSTP1 may contribute to the malignant progression and drug-resistant phenotype of these tumors. ^ The third major finding in this study is that the GSTP1 protein, an inhibitor of JNKs, undergoes significant phosphorylation in tumor cells with activated JNK signaling pathway and in those under oxidative stress. Following phosphorylation by JNK, the ability of GSTP1 to inhibit JNK downstream function, i.e. c-jun phosphorylation, was significantly enhanced, suggesting a feedback mechanism of regulation of JNK-mediated cellular signaling. (Abstract shortened by UMI.) ^

Regulation of Bcl-2 expression by the product of the prostate apoptosis response gene -4, Par-4

Elevated expression levels of the bcl-2 proto-oncogene have been correlated with the appearance of androgen independence in prostate cancer. Although bcl-2 was first cloned as the t (14:18) translocation breakpoint from human follicular B cell lymphoma, the mechanism of overexpression of bcl-2 is largely undefined for advanced prostate cancer, there being no gross alterations in the gene structure. We investigated the role of the product of the prostate apoptosis response gene-4 (Par-4) and the product of the Wilms' tumor 1 gene (WT1) in the regulation of Bcl-2 expression in prostate cancer cell lines. We observed growth arrest and apoptosis, upon decreasing Bcl-2 protein and transcript in the high Bcl-2 expressing, androgen-independent prostate cancer cell lines, by all trans-retinoic acid treatment but this did not occur in the androgen-dependent cell lines expressing low levels of Bcl-2. Changes in localization of Par-4, and an induction in the expression of WT1 protein accompanied the decrease in the Bcl-2 protein and transcript following all trans-retinoic acid treatment, in the androgen-independent prostate cancer cell line. In stable clones expressing ectopic Par-4 we observed decreased Bcl-2 protein and transcript. This was accompanied by an induction in WT1 expression. Finally, we detected Par-4 and WT1 proteins binding to a previously identified WT1 binding site on the bcl-2 promoter both in vitro and in vivo leading to a decrease in transcription from the bcl-2 promoter. We conclude that Par-4 regulates Bcl-2 through a WT1 binding site on the bcl-2 promoter. ^

Molecular mechanisms involved in the regulation of cell polarity and genome stability by the p21 -activated kinase, Shk1, in the fission yeast, Schizosaccharomyces pombe

The essential p21-activated kinase (PAK), Shk1, is a critical component of a Ras/Cdc42/PAK complex required for cell viability, normal cell polarity, proper regulation of cytoskeletal dynamics, and sexual differentiation in the fission yeast, Schizosaccharomyces pombe. While cellular functions of PAKs have been described in eukaryotes from yeasts to mammals, the molecular mechanisms of PAK regulation and function are poorly understood. This study has characterized a novel Shk1 inhibitor, Skb15, and, in addition, identified the cell polarity regulator, Tea1, as a potential biological substrate of Shk1 in S. pombe. Skb15 is a highly conserved WD repeat protein that was discovered from a two-hybrid screen for proteins that interact with the catalytic domain of Shk1. Molecular data indicate that Skb15 negatively regulates Shk1 kinase activity in S. pombe cells. A null mutation in the skb15 gene is lethal and results in deregulation of actin polymerization and localization, microtubule biogenesis, and the cytokinetic machinery, as well as a substantial uncoupling of these processes from the cell cycle. Loss of Skb15 function is suppressed by partial loss of Shk1, demonstrating that negative regulation of Shk1 by Skb15 is required for proper execution of cytoskeletal remodeling and cytokinetic functions. A mouse homolog of Skb15 can substitute for its counterpart in fission yeast, demonstrating that Skb15 protein function has been substantially conserved through evolution. ^ Our laboratory has recently demonstrated that Shk1, in addition to regulating actin cytoskeletal organization, is required for proper regulation of microtubule dynamics in S. pombe cells. The Shk1 protein localizes to interphase and mitotic microtubules, the septum-forming region, and cell ends. This pattern of localization overlaps with that of the cell polarity regulator, Tea1, in S. pombe cells. The tea1 gene was identified by Paul Nurse's laboratory from a screen for genes involved in the control of cell morphogenesis in S. pombe. In contrast to wild type S. pombe cells, which are rod shaped, tea1 null cells are often bent and/or branched in shape. The Tea1 protein localizes to the cell ends, like Shk1, and the growing tips of interphase microtubules. Thus, experiments were performed to investigate whether Tea1 interacts with Shk1. The tea1 null mutation strongly suppresses the loss of function of Skb15, an essential inhibitor of Shk1 function. All defects associated with the skb15 mutation, including defects in F-actin organization, septation, spindle elongation, and chromosome segregation, are suppressed by tea1Δ, suggesting that Tea1 may function in these diverse processes. Consistent with a role for Tea1 in cytokinesis, tea1Δ cells have a modest cell separation defect that is greatly exacerbated by a shk1 mutation and, like Shk1, Tea1 localizes to the septation site. Molecular analyses showed that Tea1 phosphorylation is significantly dependent on Shk1 function in vivo and that bacterially expressed Tea1 protein is directly phosphorylated by recombinant Shk1 kinase in vitro. Taken together, these results identify Tea1 as a potential biological substrate of Shk1 in S. pombe. ^ In summary, this study provides new insights into a conserved regulatory mechanism for PAKs, and also begins to uncover the molecular mechanisms by which the Ras/Cdc42/PAK complex regulates the microtubule and actin cytoskeletons and cell growth polarization in fission yeast. ^

Regulation of tyrosine hydroxylase gene expression by mRNA stabilization

Tyrosine hydroxylase (TH) expression increases in adrenal chromaffin cells treated with the nicotinic agonist, dimethylphenylpiperazinium (DMPP; 1 μM). We are using this response as a model of the changes in TH level that occur during increased cholinergic neural activity. Here we report a 4-fold increase in TH mRNA half-life in DMPP-treated chromaffin cells that is apparent when using a pulse-chase analysis to measure TH mRNA half-life. No increase is apparent using actinomycin D to measure half-life, indicating a requirement for ongoing transcription. Characterization of protein binding to the TH 3′UTR using RNA electro-mobility shift assays show the presence of two complexes both of which are increased by DMPP-treatment. The faster migrating complex (FMC) increases 2.5-fold and the slower migrating complex (SMC) increases 1.5-fold. Separation of UV crosslinked RNA-protein complexes on SDS polyacrylamide gels shows FMC to contain a single protein whereas SMC contains two proteins. Northwesterns yielded similar results. Transfection studies reveal an increase in expression of the full-length TH transcript due to DMPP-treatment similar to that of endogenous TH mRNA. This finding suggests the increased expression is due primarily to mRNA stabilization. Transfection of luciferase reporter constructs containing regions of the TH 3′UTR reveal only the full-length 3′UTR influenced the expression level of reporter transcripts. ^

Expression regulation of AP -2 gamma gene

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^