74 resultados para Bagg albino mouse


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chronic inflammation is an established risk factor in the pathogenesis of many cancers. Pancreatic ductal adenocarcinoma, a malignancy with a particularly dismal prognosis, is no exception. Cyclooxygenase-2, a key enzyme induced by tissue injury, has a critical role in the generation of bioactive lipids known as prostaglandins. COX-2 overexpression is a frequent finding in pancreatic cancer, chronic pancreatitis and pancreatic intraepithelial neoplasias. To explore mechanisms through which chronic inflammation establishes and maintains a protumorigenic environment, we designed a mouse model overexpressing COX-2 in pancreatic parenchyma (BK5.COX-2 mice). We discovered that constitutive expression of COX-2 has a number of important sequelae, including upregulation of additional eicosanoid-generating enzymes and proinflammatory cytokines. Many of these molecular alterations precede the onset of significant histopathological changes. Increased levels of prostaglandins E2, D2, and F2α, 5-, 12-, and 15-hydroxyeiosatetraenoic acid (HETEs) were documented in tumors and pancreata of younger transgenic mice. Using a TaqMan™ Mouse Immune Panel, we detected elevated mRNAs for a number of proinflammatory cytokines (e.g., TNFα, IL-1β, IL-6). ^ Histological examination revealed early changes in the pancreas with similarities to human chronic pancreatitis, including loss of acinar cells, appearance of metaplastic ducts, and increased deposition of stroma. As the lesions progress, features typical of dysplastic and neoplastic cells emerged within the metaplastic ductal complexes, including cellular and nuclear atypia, crowding of cells, and loss of normal tissue architecture. The amount of fibroinflammatory stroma increased considerably; numerous small vessels were evident. A number of immunocytes from both the myeloid and lymphoid lineages were identified in transgenic pancreata. Neutrophils were the earliest to infiltrate, followed shortly by macrophages and mast cells. B and T cells generally began to appear by 8–12 weeks, and organized aggregates of lymphoid cells were often found in advanced lesions. ^ We tested the efficacy of several chemopreventive agents in this model, including celecoxib, a COX-2 selective inhibitor, pentoxifylline, a cytokine inhibitor, curcumin, a polyphenol with antioxidant and anti-inflammatory properties, and GW2974, a dual EGFR/ErbB2 inhibitor. Effects on lesion development were modest in the GW2974 and pentoxifylline treated groups, but significant prevention effects were observed with curcumin and celecoxib. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Atherosclerosis is a complex disease resulting from interactions of genetic and environmental risk factors leading to heart failure and stroke. Using an atherosclerotic mouse model (ldlr-/-, apobec1-/- designated as LDb), we performed microarray analysis to identify candidate genes and pathways, which are most perturbed in changes in the following risk factors: genetics (control C57BL/6 vs. LDb mice), shearstress (lesion-prone vs. lesion-resistant regions in LDb mice), diet (chow vs. high fat fed LDb mice) and age (2-month-old vs. 8-month old LDb mice). ^ Atherosclerotic lesion quantification and lipid profile studies were performed to assess the disease phenotype. A microarray study was performed on lesion-prone and lesion-resistant regions of each aorta. Briefly, 32 male C57BL/6 and LDb mice (n =16/each) were fed on either chow or high fat diet, sacrificed at 2- and 8-months old, and RNA isolated from the aortic lesion-prone and aortic lesion-resistant segments. Using 64 Affymetrix Murine 430 2.0 chips, we profiled differentially expressed genes with the cut off value of FDR ≤ 0.15 for t-test, and q <0.0001 for the ANOVA. The data were normalized using two normalization methods---invariant probe sets (Loess) and Quantile normalization, the statistical analysis was performed using t-tests and ANOVA, and pathway characterization was done using Pathway Express (Wayne State). The result identified the calcium signaling pathway as the most significant overrepresented pathway, followed by focal adhesion. In the calcium signaling pathway, 56 genes were found to be significantly differentially expressed out of 180 genes listed in the KEGG calcium signaling pathway. Nineteen of these genes were consistently identified by both statistical tests, 11 of which were unique to the test, and 26 were unique to the ANOVA test, using the cutoffs noted above. ^ In conclusion, this finding suggested that hypercholesterolemia drives the disease progression by altering the expression of calcium channels and regulators which subsequently results in cell differentiation, growth, adhesion, cytoskeletal change and death. Clinically, this pathway may serve as an important target for future therapeutic intervention, and thus the calcium signaling pathway may serve as an important target for future diagnostic and therapeutic intervention. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pulmonary fibrosis is a devastating and lethal lung disease with no current cure. Research into cellular signaling pathways able to modulate aspects of pulmonary inflammation and fibrosis will aid in the development of effective therapies for its treatment. Our laboratory has generated a transgenic/knockout mouse with systemic elevations in adenosine due to the partial lack of its metabolic enzyme, adenosine deaminase (ADA). These mice spontaneously develop progressive lung inflammation and severe pulmonary fibrosis suggesting that aberrant adenosine signaling is influencing the development and/or progression of the disease in these animals. These mice also show marked increases in the pro-fibrotic mediator, osteopontin (OPN), which are reversed through ADA therapy that serves to lower lung adenosine levels and ameliorate aspects of the disease. OPN is known to be regulated by intracellular signaling pathways that can be accessed through adenosine receptors, particularly the low affinity A2BR receptor, suggesting that adenosine receptor signaling may be responsible for the induction of OPN in our model. In-vitro, adenosine and the broad spectrum adenosine receptor agonist, NECA, were able to induce a 2.5-fold increase in OPN transcripts in primary alveolar macrophages. This induction was blocked through antagonism of the A2BR receptor pharmacologically, and through the deletion of the receptor subtype in these cells genetically, supporting the hypothesis that the A2BR receptor was responsible for the induction of OPN in our model. These findings demonstrate for the first time that adenosine signaling is an important modulator of pulmonary fibrosis in ADA-deficient mice and that this is in part due to signaling through the A2BR receptor which leads to the induction of the pro-fibrotic molecule, otseopontin. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cell differentiation and pattern formation are fundamental processes in animal development that are under intense investigation. The mouse retina is a good model to study these processes because it has seven distinct cell types, and three well-laminated nuclear layers that form during embryonic and postnatal life. β-catenin functions as both the nuclear effector for the canonical Wnt pathway and a cell adhesion molecule, and is required for the development of various organs. To study the function of β-catenin in retinal development, I used a Cre-loxP system to conditionally ablate β-catenin in the developing retina. Deletion of β-catenin led to disrupted laminar structure but did not affect the differentiation of any of the seven cell types. Eliminating β-catenin did not reduce progenitor cell proliferation, although enhanced apoptosis was observed. Further analysis showed that disruption of cell adhesion was the major cause of the observed patterning defects. Overexpression of β-catenin during retinal development also disrupted the normal retinal lamination and caused a transdifferentiation of neurons into pigmented cells. The results indicate that β-catenin functions as a cell adhesion molecule but not as a Wnt pathway component during retinal neurogenesis, and is essential for lamination but not cell differentiation. The results further imply that retinal lamination and cell differentiation are genetically separable processes. ^ Sonic hedgehog (shh) is expressed in retinal ganglion cells under the control of transcription factor Pou4f2 during retinal development. Previous studies identified a phylogenetically conserved region in the first intron of shh containing a Pou4f2 binding site. Transgenic reporter mice in which reporter gene expression was driven by this region showed that this element can direct gene expression specifically in the retina, but expression was not limited to the ganglion cells. From these data I hypothesized that this element is required for shh expression in the retina but is not sufficient for specific ganglion cell expression. To further test this hypothesis, I created a conditional allele by flanking this region with two loxP sites. Lines carrying this allele will be crossed with retinal-specific Cre lines to remove this element in the retina. My hypothesis predicts that alteration in shh expression and subsequent retinal defects will occur in the retinas of these mice. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tuberous sclerosis complex (TSC) is a dominant tumor suppressor disorder caused by mutations in either TSC1 or TSC2. The proteins of these genes form a complex to inhibit the mammalian target of rapamycin complex 1 (mTORC1), which controls protein translation and cell growth. TSC causes substantial neuropathology, often leading to autism spectrum disorders (ASDs) in up to 60% of patients. The anatomic and neurophysiologic links between these two disorders are not well understood. However, both disorders share cerebellar abnormalities. Therefore, we have characterized a novel mouse model in which the Tsc2 gene was selectively deleted from cerebellar Purkinje cells (Tsc2f/-;Cre). These mice exhibit progressive Purkinje cell degeneration. Since loss of Purkinje cells is a well-reported postmortem finding in patients with ASD, we conducted a series of behavior tests to assess if Tsc2f/-;Cre mice displayed autistic-like deficits. Using the three chambered social choice assay, we found that Tsc2f/-;Cre mice showed behavioral deficits, exhibiting no preference between a stranger mouse and an inanimate object, or between a novel and a familiar mouse. Tsc2f/-;Cre mice also demonstrated increased repetitive behavior as assessed with marble burying activity. Altogether, these results demonstrate that loss of Tsc2 in Purkinje cells in a haploinsufficient background lead to behavioral deficits that are characteristic of human autism. Therefore, Purkinje cells loss and/or dysfunction may be an important link between TSC and ASD. Additionally, we have examined some of the cellular mechanisms resulting from mutations in Tsc2 leading to Purkinje cell death. Loss of Tsc2 led to upregulation of mTORC1 and increased cell size. As a consequence of increased protein synthesis, several cellular stress pathways were upregulated. Principally, these included altered calcium signaling, oxidative stress, and ER stress. Likely as a consequence of ER stress, there was also upregulation of ubiquitin and autophagy. Excitingly, treatment with an mTORC1 inhibitor, rapamycin attenuated mTORC1 activity and prevented Purkinje cell death by reducing of calcium signaling, the ER stress response, and ubiquitin. Remarkably, rapamycin treatment also reversed the social behavior deficits, thus providing a promising potential therapy for TSC-associated ASD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cancer therapy and tumor treatment remain unsolved puzzles. Genetic screening for tumor suppressor genes in Drosophila revealed the Hippo-signaling pathway as a kinase cascade consisting of five core components. Disrupting the pathway by deleting the main component genes breaks the balance of cell proliferation and apoptosis and results in epithelial tissue tumorigenesis. The pathway is therefore believed to be a tumor suppressor pathway. However, a corresponding role in mammals is yet to be determined. Our lab began to investigate the tumor suppression function of the potent mammalian Hippo pathway by putting floxed alleles into the mouse genome flanking the functional-domain-expressing exons in each component (Mst1, Mst2, Sav1, Lats1 and Lats2). These mice were then crossed with different cre-mouse lines to generate conditional knockout mice. Results indicate a ubiquitous tumor suppression function of these components, predominantly in the liver. A further liver specific analysis of the deletion mutation of these components, as well as the Yap/Taz double deletion mutation, reveals essential roles of the Hippo pathway in regulating hepatic quiescence and embryonic liver development. One of the key cellular mechanisms for the Hippo pathway’s involvement in these liver biological events is likely its cell cycle regulation function. Our work will help to develop potential therapeutic approaches for liver cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hemophilia A is a clotting disorder caused by functional factor VIII (FVIII) deficiency. About 25% of patients treated with therapeutic recombinant FVIII develop antibodies (inhibitors) that render subsequent FVIII treatments ineffective. The immune mechanisms of inhibitor formation are not entirely understood, but circumstantial evidence indicates a role for increased inflammatory response, possibly via stimulation of Toll-like receptors (TLRs), at the time of FVIII immunization. I hypothesized that stimulation through TLR4 in conjunction with FVIII treatments would increase the formation of FVIII inhibitors. To test this hypothesis, FVIII K.O. mice were injected with recombinant human FVIII with or without concomitant doses of TLR4 agonist (lipopoysaccharide; LPS). The addition of LPS combined with FVIII significantly increased the rate and the production of anti-FVIII IgG antibodies and neutralizing FVIII inhibitors. In the spleen, repeated in vivo TLR4 stimulation with LPS increased the relative percentage of macrophages and dendritic cells (DCs) over the course of 4 injections. However, repeated in vivo FVIII stimulation significantly increased the density of TLR4 expressed on the surface of all spleen antigen presenting cells (APCs). Culture of splenocytes isolated from mice revealed that the combined stimulation of LPS and FVIII also synergistically increased early secretion of the inflammatory cytokines IL-6, TNF-α, and IL-10, which was not maintained throughout the course of the repeated injections. While cytokine secretion was relatively unchanged in response to FVIII re-stimulation in culture, LPS re-stimulation in culture induced increased and prolonged inflammatory cytokine secretion. Re-stimulation with both LPS and FVIII induced cytokine secretion similar to LPS stimulation alone. Interestingly, long term treatment of mice with LPS alone resulted in splenocytes that showed reduced response to FVIII in culture. Together these results indicated that creating a pro-inflammatory environment through the combined stimulation of chronic, low-dose LPS and FVIII changed not only the populations but also the repertoire of APCs in the spleen, triggering the increased production of FVIII inhibitors. These results suggested an anti-inflammatory regimen should be instituted for all hemophilia A patients to reduce or delay the formation of FVIII inhibitors during replacement therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The availability of transplantable, syngeneic murine melanomas made it possible to study the potential effects of UV radiation on the growth and progression of melanomas in an animal model. The purpose of my study was to determine how UV-irradiation increases the incidence of melanoma out-growth, when syngeneic melanoma cells are transplanted into a UV-irradiated site. Short term intermittent UVB exposure produces a transitory change in the mice which allows the increased outgrowth of melanoma cells injected into the UV-irradiated site. One possible mechanism is an immunomodulatory effect of UVR on the host. An alternative mechanism to account for the increased tumor incidence in the UV-irradiated site, is the release of inflammatory mediators from UV-irradiated epidermal cells. A third possibility is that UVR could induce the production and/or release of melanoma-specific growth factors resulting in increased melanoma outgrowth.^ My first step in distinguishing among these different possible mechanisms was to characterize further the conditions leading to increased development of melanoma cells in UV-irradiated mouse skin. Next, I attempted to determine which of the 3 proposed mechanisms was most likely. To do this, I defined the specificity of the effect by examining the growth of additional C3H tumorigenic cell lines in UV-irradiated skin. Second, I determined the immunogenicity of these tumor cell lines. The tumor cell lines exhibiting increased tumor incidence are restricted to those tumor cell lines which are immunogenic in normal C3H mice. Third, I determined the effect of UVR on melanoma development did not occur in immunosuppressed mice.^ Because of results from these three lines of investigation suggested that the effect was immunologically mediated, I then investigated whether specific immune reactions were affected by local UV irradiation. To accomplish this, I investigated the effect of UVR on cutaneous immune cells and on induction of contact hypersensitivity (CHS), and I also determined the effect of UVR on the development and the expression of systemic immunity against the melanoma cells. There is no clear cut relationship between the number of Langerhans or Thy1+ cells and the UV effect on tumor incidence. Furthermore, there was no suppression of CHS in the UV-irradiated mice. While the development of systemic immunity is significantly reduced, it appears to be sufficient to provide in vivo immunity to tumor challenge. However the elicitation of tumor immunity in immunized mice can be abrogated if tumor challenge occurs in the site of UV irradiation. This investigation provides new information on an effect of UVR on the elicitation of tumor immunity. Furthermore, it indicates that UV radiation can play a role in the development of melanoma other than just in the transformation of melanocytes. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A fundamental task in developmental biology is to understand the molecular mechanisms governing early embryogenesis. The aim of this study was to understand the developmental role of a putative basic helix-loop-helix (b-HLH) transcription factor, twist, during mouse embryogenesis.^ twist was originally identified in Drosophila as one of the zygotic genes, including snail, that were required for dorsal-ventral patterning. In Drosophila embryogenesis, twist is expressed in the cells of the ventral midline destined to form mesoderm. In embryos lacking twist expression, their ventral cells fail to form a ventral furrow and subsequently no mesoderm is formed.^ During mouse embryogenesis, twist is expressed after initial mesoderm formation in both mesoderm and cranial neural crest cell derivatives. To study the role of twist in vivo, twist-null embryos were generated by gene targeting. Embryos homozygous for the twist mutation die at midgestation. The most prominent phenotype in the present study was a failure of the cranial neural tube to close (exencephaly). twist-null embryos also showed defects in head mesenchyme, branchial arches, somites, and limb buds.^ To understand whether twist functions cell-autonomously and to investigate how twist-null cells interact with wild-type cells in vivo, twist chimeras composed of both twist-null and wild-type cells marked by the expression of the lacZgene were generated. Chimeric analysis revealed a correlation between the incidence of exencephaly and the contribution of the underlying twist-null head mesenchyme, thus strongly suggesting that twist-expressing head mesenchyme is required for the closure of the cranial neural tube. These studies have identified twist as a critical regulator for the mesenchymal fate determination within the cranial neural crest lineage. Most strikingly, twist-null head mesenchyme cells were always segregated from wild-type cells, indicating that the twist mutation altered the adhesive specificity of these cells. Furthermore, these results also indicated that twist functions cell-autonomously in the head, arch, and limb mesenchyme but non-cell-autonomously in the somites. Taken together, these studies have established the essential role of twist during mouse embryogenesis. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single-locus mutations in mice can express epileptic phenotypes and provide critical insights into the naturally occurring defects that alter excitability and mediate synchronization in the central nervous system (CNS). One such recessive mutation (on chromosome (Chr) 15), stargazer(stg/stg) expresses frequent bilateral 6-7 cycles per second (c/sec) spike-wave seizures associated with behavioral arrest, and provides a valuable opportunity to examine the inherited lesion associated with spike-wave synchronization.^ The existence of distinct and heterogeneous defects mediating spike-wave discharge (SWD) generation has been demonstrated by the presence of multiple genetic loci expressing generalized spike-wave activity and the differential effects of pharmacological agents on SWDs in different spike-wave epilepsy models. Attempts at understanding the different basic mechanisms underlying spike-wave synchronization have focused on $\gamma$-aminobutyric acid (GABA) receptor-, low threshold T-type Ca$\sp{2+}$ channel-, and N-methyl-D-aspartate receptor (NMDA-R)-mediated transmission. It is believed that defects in these modes of transmission can mediate the conversion of normal oscillations in a trisynaptic circuit, which includes the neocortex, reticular nucleus and thalamus, into spike-wave activity. However, the underlying lesions involved in spike-wave synchronization have not been clearly identified.^ The purpose of this research project was to locate and characterize a distinct neuronal hyperexcitability defect favoring spike-wave synchronization in the stargazer brain. One experimental approach for anatomically locating areas of synchronization and hyperexcitability involved an attempt to map patterns of hypersynchronous activity with antibodies to activity-induced proteins.^ A second approach to characterizing the neuronal defect involved examining the neuronal responses in the mutant following application of pharmacological agents with well known sites of action.^ In order to test the hypothesis that an NMDA receptor mediated hyperexcitability defect exists in stargazer neocortex, extracellular field recordings were used to examine the effects of CPP and MK-801 on coronal neocortical brain slices of stargazer and wild type perfused with 0 Mg$\sp{2+}$ artificial cerebral spinal fluid (aCSF).^ To study how NMDA receptor antagonists might promote increased excitability in stargazer neocortex, two basic hypotheses were tested: (1) NMDA receptor antagonists directly activate deep layer principal pyramidal cells in the neocortex of stargazer, presumably by opening NMDA receptor channels altered by the stg mutation; and (2) NMDA receptor antagonists disinhibit the neocortical network by blocking recurrent excitatory synaptic inputs onto inhibitory interneurons in the deep layers of stargazer neocortex.^ In order to test whether CPP might disinhibit the 0 Mg$\sp{2+}$ bursting network in the mutant by acting on inhibitory interneurons, the inhibitory inputs were pharmacologically removed by application of GABA receptor antagonists to the cortical network, and the effects of CPP under 0 Mg$\sp{2+}$aCSF perfusion in layer V of stg/stg were then compared with those found in +/+ neocortex using in vitro extracellular field recordings. (Abstract shortened by UMI.) ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Missense mutations in the p53 tumor-suppressor gene are the most common alterations of p53 in somatic tumors and in patients with Li-Fraumeni syndrome. p53 missense mutations occur in the DNA binding region and disrupt the ability of p53 to activate transcription. In vitro studies have shown that some p53 missense mutants have a gain-of-function or dominant-negative activity. ^ The p53 175 Arg-to-His (p53 R175H) mutation in humans has been shown to have dominant-negative and gain-of-function properties in vitro. This mutation is observed in the germline of individuals with Li-Fraumeni syndrome. To accurately model Li-Fraumeni syndrome and to examine the mechanistic nature of a gain-of-function missense mutation on in vivo tumorigenesis, we generated and characterized a mouse with the corresponding mutation, p53 R172H. p53R172H homozygous and heterozygous mice developed similar tumor spectra and survival curves as p53 −/− and p53+/− mice, respectively. However, tumors in p53+/R172H mice metastasized to various organs with high frequency, suggesting a gain-of-function phenotype by p53R172H in vivo. Mouse embryonic fibroblasts (MEFs) from p53R172H mice also showed gain-of-function phenotypes in cell proliferation, DNA synthesis, and transformation potential, while cells from p53+/− and p53−/− mice did not. ^ To mechanistically characterize the gain-of-function phenotype of the p53R172H mutant, the role of p53 family members, p63 and p73, was analyzed. Disruption of p63 and p73 by siRNAs in p53 −/− MEFs increased transformation potential and reinitiated DNA synthesis to levels observed in p53R172H/R172H cells. Additionally, p63 and p73 were bound and functionally inactivated by p53R172H in metastatic p53 R172H tumor-derived cell lines, indicating a role for the p53 family members in the gain-of-function phenotype. This study provides in vivo evidence for the gain-of-function effect of p53 missense mutations and more accurately models the Li-Fraumeni syndrome. ^