Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Cis-acting elements and developmental regulators govern toxin gene expression in Bacillus anthracis

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

Characterization of glucocorticoid receptor (NR3C1) gene polymorphisms and a family-based association study with hypertension

Hypertension is usually defined as having values of systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg. Hypertension is one of the main adverse effects of glucocorticoid on the cardiovascular system. Glucocorticoids are essential hormones, secreted from adrenal glands in circadian fashion. Glucocorticoid's effect on blood pressure is conveyed by the glucocorticoid receptor (NR3C1), an omnipresent nuclear transcription factor. Although polymorphisms in this gene have long been implicated to be a causal factor for cardiovascular diseases such as hypertension, no study has yet thoroughly interrogated the gene's polymorphisms for their effect on blood pressure levels. Therefore, I have first resequenced ∼30 kb of the gene, encompassing all exons, promoter regions, 5'/3' UTRs as well as at least 1.5 kb of the gene's flanking regions from 114 chromosome 5 monosomic cell lines, comprised of three major American ethnic groups—European American, African American and Mexican American. I observed 115 polymorphisms and 14 common molecularly phased haplotypes. A subset of markers was chosen for genotyping study populations of GENOA (Genetic Epidemiology Network of Atherosclerosis; 1022 non-Hispanic whites, 1228 African Americans and 954 Mexican Americans). Since these study populations include sibships, the family-based association test was performed on 4 blood pressure-related quantitative variables—pulse, systolic blood pressure, diastolic blood pressure and mean arterial pressure. Using these analyses, multiple correlated SNPs are significantly protective against high systolic blood pressure in non-Hispanic whites, which includes rsb198, a SNP formerly associated with beneficial body compositions. Haplotype association analysis also supports this finding and all p-values remained significant after permutation tests. I therefore conclude that multiple correlated SNPs on the gene may confer protection against high blood pressure in non-Hispanic whites. ^

Transcriptional and translational regulators of gene expression in germ cell development

Germ cell development is a highly coordinated process driven, in part, by regulatory mechanisms that control gene expression. Not only transcription, but also translation, is under regulatory control to direct proper germ cell development. In this dissertation, I have focused on two regulators of germ cell development. One is the homeobox protein RHOX10, which has the potential to be both a transcriptional and translational regulator in mouse male germ cell development. The other is the RNA-binding protein, Hermes, which functions as a translational regulator in Xenopus laevis female germ cell development. ^ Rhox10 is a member of reproductive homeobox gene X-(linked (Rhox) gene cluster, of which expression is developmentally regulated in developing mouse testes. To identify the cell types and developmental stages in which Rhox10 might function, I characterized its temporal and spatial expression pattern in mouse embryonic, neonatal, and adult tissues. Among other things, this analysis revealed that both the level and the subcellular localization of RHOX10 are regulated during germ cell development. To understand the role of Rhox10 in germ cell development, I generated transgenic mice expressing an artificial microRNA (miRNA) targeting Rhox10. While this artificial miRNA robustly downregulated RHOX10 protein expression in vitro, it did not significantly reduce RHOX10 expression in vivo. So I next elected to knockdown RHOX10 levels in spermatogonial stem cells (SSCs), which I found highly express both Rhox10 mRNA and RHOX10 protein. Using a recently developed in vitro culture system for SSCs combined with a short-hairpin RNA (shRNA) approach, I strongly depleted RHOX10 expression in SSCs. These RHOX10-depleted cells exhibited a defect in the ability to form stem cell clusters in vitro. Expression profiling analysis revealed many genes regulated by Rhox10, including many meiotic genes, which could be downstream of Rhox10 in a molecular pathway that controls SSC differentiation. ^ RNA recognition motif (RRM) containing protein, Hermes is localized in germ plasm, where dormant mRNAs are also located, of Xenopus oocytes, which implicates its role in translational regulator. To understand the function of Hermes in oocyte meiosis, I used a morpholino oligonucleotide (MO) based knockdown approach. Microinjection of Hermes MO into fully grown oocytes, which are arrested in meiotic prophase, caused acceleration of oocytes reentry into meiosis (i.e., maturation) upon progesterone induction. Using a candidate approach, I identified at least three targets of Hermes: Ringo/Spy, Xcat2, and Mos. Ringo/Spy and Mos are known to have functions in oocyte maturation, while Ringo/Spy, Xcat2 mRNA are localized in the germ plasm of oocytes, which drives germ cell specification after fertilization. This led me to propose that Hermes functions in both oocyte maturation and germ cell development through its ability to regulate 3 crucial target mRNAs. ^

From protein microarray to biology: The discovery of epigenetic regulatory molecules

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Network-based genome-wide association study of Crohn's disease

Genome-wide association studies (GWAS) have rapidly become a standard method for disease gene discovery. Many recent GWAS indicate that for most disorders, only a few common variants are implicated and the associated SNPs explain only a small fraction of the genetic risk. The current study incorporated gene network information into gene-based analysis of GWAS data for Crohn's disease (CD). The purpose was to develop statistical models to boost the power of identifying disease-associated genes and gene subnetworks by maximizing the use of existing biological knowledge from multiple sources. The results revealed that Markov random field (MRF) based mixture model incorporating direct neighborhood information from a single gene network is not efficient in identifying CD-related genes based on the GWAS data. The incorporation of solely direct neighborhood information might lead to the low efficiency of these models. Alternative MRF models looking beyond direct neighboring information are necessary to be developed in the future for the purpose of this study.^

ADHERENS JUNCTIONS AND THE ACTOMYOSIN NETWORK REGULATE ORGAN GROWTH BY MODULATING HIPPO PATHWAY ACTIVITY IN DROSOPHILA

Adherens junctions (AJs) and basolateral modules are important for the establishment and maintenance of apico-basal polarity. Loss of AJs and basolateral module members lead to tumor formation, as well as poor prognosis for metastasis. Recently, in mammalian studies it has been shown that loss of either AJ or basolateral module members deregulate Yorkie activity, the downstream transcriptional effector of the Hippo pathway. Importantly, it is unclear if AJ and basolateral components act through the same or parallel mechanisms to regulate Yorkie activity. Here, we dissect how loss of AJ and basolateral components affects Hippo signaling in Drosophila. Surprisingly, while scrib knock-down tissue displays increased reporter activity autonomously, α-cat knock-down tissue shows a cell autonomous decrease and a cell non-autonomous increase of Hippo reporter activity. We provided several lines of evidence to show the differential regulation in polarity protein localizations and oncogenic cooperative overgrowth by AJs and basolateral complexes. Finally, we show that Hippo pathway activity is induced in α-cat and scrib double knocked-down tissue. Taken together, our results provide evidence to show that basolateral modules and AJs act in parallel to modulate Hippo pathway activity. Non-muscle myosin II is an actomyosin component that interacts with the actin. Non-muscle myosin II also interacts with lgl, though the function of this interaction is not clear. Our lab demonstrated that modulating F-actin regulates Hippo pathway activity, and lgl also has been described as a Hippo pathway regulator. Therefore we suspect that myosin II is also involved in Hippo pathway regulation. We first characterized non-muscle Myosin II as a novel tumor suppressor gene by affecting Hippo pathway activity. Upstream regulators of Myosin II, members in the Rho signaling pathway, also displayed similar phenotypes as the Myosin II knock-down tissues. Apoptosis is also induced in myosin II knock-down tissues, however, blocking cell death does not affect myosin II knock-down induced Hippo activation. Our data suggested hyperactivating myosin II induced F-actin accumulation so therefore induces Hippo target activation. Unexpectedly, we also observed that reducing F-actin activity induced Hippo target activation in vivo. These controversial data indicated that actomyosin may regulate the Hippo pathway through multiple mechanisms.

Gene-gene interaction and gene-pathway analysis of genome-wide association for schizophrenia

Schizophrenia (SZ) is a complex disorder with high heritability and variable phenotypes that has limited success in finding causal genes associated with the disease development. Pathway-based analysis is an effective approach in investigating the molecular mechanism of susceptible genes associated with complex diseases. The etiology of complex diseases could be a network of genetic factors and within the genes, interaction may occur. In this work we argue that some genes might be of small effect that by itself are neither sufficient nor necessary to cause the disease however, their effect may induce slight changes to the gene expression or affect the protein function, therefore, analyzing the gene-gene interaction mechanism within the disease pathway would play crucial role in dissecting the genetic architecture of complex diseases, making the pathway-based analysis a complementary approach to GWAS technique. ^ In this study, we implemented three novel linkage disequilibrium based statistics, the linear combination, the quadratic, and the decorrelation test statistics, to investigate the interaction between linked and unlinked genes in two independent case-control GWAS datasets for SZ including participants of European (EA) and African (AA) ancestries. The EA population included 1,173 cases and 1,378 controls with 729,454 genotyped SNPs, while the AA population included 219 cases and 288 controls with 845,814 genotyped SNPs. We identified 17,186 interacting gene-sets at significant level in EA dataset, and 12,691 gene-sets in AA dataset using the gene-gene interaction method. We also identified 18,846 genes in EA dataset and 19,431 genes in AA dataset that were in the disease pathways. However, few genes were reported of significant association to SZ. ^ Our research determined the pathways characteristics for schizophrenia through the gene-gene interaction and gene-pathway based approaches. Our findings suggest insightful inferences of our methods in studying the molecular mechanisms of common complex diseases.^

Network-based analysis of genome-wide scans of natural selection

The genomic era brought by recent advances in the next-generation sequencing technology makes the genome-wide scans of natural selection a reality. Currently, almost all the statistical tests and analytical methods for identifying genes under selection was performed on the individual gene basis. Although these methods have the power of identifying gene subject to strong selection, they have limited power in discovering genes targeted by moderate or weak selection forces, which are crucial for understanding the molecular mechanisms of complex phenotypes and diseases. Recent availability and rapid completeness of many gene network and protein-protein interaction databases accompanying the genomic era open the avenues of exploring the possibility of enhancing the power of discovering genes under natural selection. The aim of the thesis is to explore and develop normal mixture model based methods for leveraging gene network information to enhance the power of natural selection target gene discovery. The results show that the developed statistical method, which combines the posterior log odds of the standard normal mixture model and the Guilt-By-Association score of the gene network in a naïve Bayes framework, has the power to discover moderate/weak selection gene which bridges the genes under strong selection and it helps our understanding the biology under complex diseases and related natural selection phenotypes.^

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Regulation of {\it neu\/} gene expression by the simian virus 40 large T antigen and tumor suppressors Rb and p53

The neu gene (also c-erbB-2 or HER2) encodes a 185 kilodalton protein that is frequently overexpressed in breast, ovarian and non-small cell lung cancers. Study of the regulation of neu indicates that neu gene expression can be modulated by c-myc or by the adenovirus 5 E1a gene product. This study demonstrates that the transforming protein, large T antigen, of the simian virus 40 represses neu promoter activity. Repression of neu by large T antigen is mediated through the region $-$172 to $-$79 (relative to first ATG) of the neu promoter--unlike through $-$312 to $-$172 for c-myc or E1a. This suggests a different pathway for repression of neu by large T antigen. The 10 amino acid region of large T required for binding the tumor suppressor, retinoblastoma gene product, Rb, is not necessary for repression of neu. Moreover, the tumor suppressors, Rb and p53 can independently inhibit neu promoter activity. Rb inhibits neu through a 10 base pair G-rich enhancer (GTG element) ($-$243 to $-$234) and also through regions close to transcription initiation sites ($-$172 to $-$79). Mutant Rb unable to complex large T is able to repress the region close to transcription initiation but not the GTG enhancer. Thus, Rb inhibits the two regulatory domains of the neu gene by different mechanisms. Both Rb and p53 can repress the transforming activity of activated neu in focus forming assays. These data provide evidence that tumor suppressors regulate expression of growth stimulatory genes such as neu. Therefore, one reason for the overexpression of neu that is frequently seen in breast cancer cells may be due to functional inactivation of Rb and p53 which is also a common occurrence in breast cancer cells. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

ATXA -dependent gene expression in Bacillus anthracis

The Bacillus anthracis toxin genes, cya, lef , and pag, can be viewed as a regulon, in which transcription of all three genes is activated in trans by the same regulatory gene, atxA, in response to the same signal, CO2. I determined that several phenotypes are associated with the atxA gene. In addition to being toxin-deficient, an atxA -null mutant grows poorly on minimal media and sporulates early compared to the parent strain. Furthermore, an atxA-null mutant has an altered 2-D gel protein profile. I used a genetic approach to find additional atxA-regulated genes. Random transcriptional lacZ fusions were generated in B. anthracis using transposon Tn 917-LTV3. Transposon-insertion libraries were screened for mutants expressing increased β-galactosidase activity in 5% CO2. Introduction of an atxA-null mutation in these mutants revealed that 79% of the CO2-regulated fusions were also atxA-dependent. DNA sequence analysis of transposon insertion sites in mutants carrying CO 2/atxA-regulated fusions revealed ten mutants harboring transposon insertions in loci distinct from the toxin genes. The majority of the tcr (toxin co-regulated) loci mapped within the pXO1 pathogenicity island. These results indicate a clear association of atxA with CO2-enhanced gene expression in B. anthracis and provide evidence that atxA regulates genes other than the structural genes for the anthrax toxin proteins. ^ Characterization of one tcr locus revealed a new regulatory gene, pagR. The pagR gene (300 nt) is located downstream of pag. pagR is cotranscribed with pag and is responsible for autogenous control of the operon. pagR also represses expression of cya and lef. Repression of toxin gene expression by pagR may be mediated by atxA. The steady state level of atxA mRNA is increased in a pagR mutant. Recombinant PagR protein purified from Escherichia coli did not specifically bind the promoter regions of pagA or atxA. An unidentified factor in B. anthracis crude extracts, however, was able to bind the atxA promoter in the absence of PagR or AtxA. These investigations increase our knowledge of virulence regulation in B. anthracis and ultimately will lead to a better understanding of anthrax disease. ^

Functional studies of a LIM -homeodomain transcription factor lmx1b in murine mid -hindbrain and limb development

This thesis is centered on applying molecular genetics to study pattern formation during animal development. More specifically, this thesis describes the functional studies of a LIM-homeodomain gene called lmx1b during murine embryogenesis. Lmx1b expression is restricted to the mid-hindbrain junction as well as to the dorsal mesenchyme of the limb, suggesting important functions during mid-hindbrain and limb development. To test these possibilities, lmx1b homozygous mutant mice were generated and their limb and CNS phenotypes examined. Lmx1b homozygous mutant mice exhibit a large reduction of mid-hindbrain structures, and that their limbs are symmetrical along the dorsal-ventral axis as the result of a dorsal to ventral transformation. Taken together, these studies define essential functions for lmx1b in mid-hindbrain patteming and in dorsal limb cell fate determination. However, the molecular mechanisms which accounts for these phenotypes are unknown, and whether lmx1b has same or distinctive functions during the mid-hindbrain and limb development is also unclear. ^ Recently, insight into molecular mechanisms of mid-hindbrain patterning and limb development has resulted from the identification of several factors with restricted expression patterns within these regions. These include the secreted factors wnt-1, fgf-8, wnt-7a and the transcription factors pax-2, and en-1. Targeted disruption of any of these genes in mice suggests that these genes might be involved in similar regulatory pathways. Analysis of the expression of these genes in lmx1b mutants demonstrates that lmxlb is not required for the initiation, but is required to maintain their expression at the mid-hindbrain junction. Thus, lmxlb is not required for specifying mid-hindbrain cell fates, rather, it functions to ensure the establishment or maintenance of a proper organizing center at the mid-hindbrain junction. Interestingly, lmxlb functions cell non-autonomously in chimera analysis, which indicates that lmx1b might regulate the expression of secreted factors such as wnt-1 and/or fgf-8 in the organizing center. In contrast, lmx1b functions cell autonomously in the dorsal limb to govern dorsal ventral limb development and its expression is regulated by with wnt-7a and en-1. However, single and double mutant analysis suggest that all three genes have partially overlapping functions as well as independent functions. The results point toward a complicated network of cross-talks among all three limb axes. ^

Signaling pathways in the transcriptional and post-translational regulation of the human glutathione S -transferase P1 gene

The human glutathione S-transferase P1 (GSTP1) protein is an endogenous inhibitor of c-jun N-terminal kinases (JNKs) and an important phase II detoxification enzyme. ^ Recent identification of a cAMP response element (CRE) in the 5 ′-region of the human GSTP1 gene and several putative phosphorylation sites for the Ser/Thr protein kinases, including, cAMP-dependent protein kinases (PKAs), protein kinases C (PKCs), and JNKs in the GSTP1 protein raised the possibility that signaling pathways may play an important role in the transcriptional and post-translational regulation of GSTP1 gene. This study examined (a) whether the signaling pathway mediated by CAMP, via the GSTP1 CRE, is involved in the transcriptional regulation of the GSTP1 gene, (b) whether signaling pathways mediated by the Ser/Thr protein kinases (PKAs, PKCs, and JNKs) induce post-translational modification, viz. phosphorylation of the GSTP1 protein, and (c) whether such phosphorylation of the GSTP1 protein alters its functions in metabolism and in JNK signaling. ^ The first major finding in this study is the establishment of the human GSTP1 gene as a novel CAMP responsive gene in which transcription is activated via an interaction between PKA activated CRE binding protein-1 (CREB-1) and the CRE in the 5′-regulatory region. ^ The second major finding in this study is the observation that the GSTP1 protein undergoes phosphorylation and functionally activated by second messenger-activated protein kinases, PKA and PKC, in tumor cells with activated signaling pathways. Following phosphorylation by PKA or PKC, the catalytic activity of the GSTP1 protein was significantly enhanced, as indicated by a decrease in its Km (2- to 3.6-fold) and an increase in Kcat/ Km (1.6- to 2.5-fold) for glutathione. Given the frequent over-expression of GSTP1 and the aberrant PKA/PKC signaling cascade observed in tumors, these findings suggest that phosphorylation of GSTP1 may contribute to the malignant progression and drug-resistant phenotype of these tumors. ^ The third major finding in this study is that the GSTP1 protein, an inhibitor of JNKs, undergoes significant phosphorylation in tumor cells with activated JNK signaling pathway and in those under oxidative stress. Following phosphorylation by JNK, the ability of GSTP1 to inhibit JNK downstream function, i.e. c-jun phosphorylation, was significantly enhanced, suggesting a feedback mechanism of regulation of JNK-mediated cellular signaling. (Abstract shortened by UMI.) ^