42 resultados para regulatory T-cell homeostasis


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two molecular epidemiological studies were conducted to examine associations between genetic variation and risk of squamous cell carcinoma of the head and neck (SCCHN). In the first study, we hypothesized that genetic variation in p53 response elements (REs) may play roles in the etiology of SCCHN. We selected and genotyped five polymorphic p53 REs as well as a most frequently studied p53 codon 72 (Arg72Pro, rs1042522) polymorphism in 1,100 non-Hispanic White SCCHN patients and 1,122 age-and sex-matched cancer-free controls recruited at The University of Texas M. D. Anderson Cancer Center. In multivariate logistic regression analysis with adjustment for age, sex, smoking and drinking status, marital status and education level, we observed that the EOMES rs3806624 CC genotype had a significant effect of protection against SCCHN risk (adjusted odds ratio= 0.79, 95% confidence interval =0.64–0.98), compared with the -838TT+CT genotypes. Moreover, a significantly increased risk associated with the combined genotypes of p53 codon 72CC and EOMES -838TT+CT was observed, especially in the subgroup of non-oropharyneal cancer patients. The values of false-positive report probability were also calculated for significant findings. In the second study, we assessed the association between SCCHN risk and four potential regulatory single nucleotide polymorphisms (SNPs) of DEC1 (deleted in esophageal cancer 1) gene, a candidate tumor suppressor gene for esophageal cancer. After adjustment for age, sex, and smoking and drinking status, the variant -606CC (i.e., -249CC) homozygotes had a significantly reduced SCCHN risk (adjusted odds ratio = 0.71, 95% confidence interval = 0.52–0.99), compared with the -606TT homozygotes. Stratification analyses showed that a reduced risk associated with the -606CC genotype was more pronounced in subgroups of non-smokers, non-drinkers, younger subjects (defined as ≤ 57 years), carriers of TP53 Arg/Arg (rs1042522) genotype, patients with oropharyngeal cancer or late-stage SCCHN. Further in silico analysis revealed that the -249 T-to-C change led to a gain of a transcription factor binding site. Additional functional analysis showed that the -249T-to-C change significantly enhanced transcriptional activity of the DEC1 promoter and the DNA-protein binding activity. We conclude that the DEC1 promoter -249 T>C (rs2012775) polymorphism is functional, modulating susceptibility to SCCHN among non-Hispanic Whites. Additional large-scale, preferably population-based studies are needed to validate our findings.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Growth factor signaling promotes anabolic processes via activation of the PI3K-Akt kinase cascade. Deregulation of the growth factor-dependent PI3K-Akt pathway was implicated in tumorigenesis. Akt is an essential serine/threonine protein kinase that controls multiple physiological functions such as cell growth, proliferation, and survival to maintain cellular homeostasis. Recently, the mammalian Target of Rapamycin Complex 2 (mTORC2) was identified as the main Akt Ser-473 kinase, and Ser-473 phosphorylation is required for Akt hyperactivation. However, the detailed mechanism of mTORC2 regulation in response to growth factor stimulation or cellular stresses is not well understood. In the first project, we studied the regulation of the mTORC2-Akt signaling under ER stress. We identified the inactivation of mTORC2 by glycogen synthase kinase-3β (GSK-3β). Under ER stress, the essential mTORC2 component, rictor, is phosphorylated by GSK-3β at Ser-1235. This phosphorylation event results in the inhibition of mTORC2 kinase activity by interrupting Akt binding to mTORC2. Blocking rictor Ser-1235 phosphorylation can attenuate the negative impacts of GSK-3β on mTORC2/Akt signaling and tumor growth. Thus, our work demonstrated that GSK-3β-mediated rictor Ser-1235 phosphorylation in response to ER stress interferes with Akt signaling by inhibiting mTORC2 kinase activity. In the second project, I investigated the regulation of the mTORC2 integrity. We found that basal mTOR kinase activity depends on ATP level, which is tightly regulated by cell metabolism. The ATP-sensitive mTOR kinase is required for SIN1 protein phosphorylation and stabilization. SIN1 is an indispensable subunit of mTORC2 and is required for the complex assembly and mTORC2 kinase activity. Our findings reveal that mTOR-mediated phosphorylation of SIN1 is critical for maintaining complex integrity by preventing SIN1 from lysosomal degradation. In sum, our findings verify two distinct mTORC2 regulatory mechanisms via its components rictor and SIN1. First, GSK-3β-mediated rictor Ser-1235 phosphorylation results in mTORC2 inactivation by interfering its substrate binding ability. Second, mTOR-mediated Ser-260 phosphorylation of SIN1 preserves its complex integrity. Thus, these two projects provide novel insights into the regulation of mTORC2.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE Publication No.___________ Lisa Harn-Ging Shiue, B.S. Supervisory Professor: Madeleine Duvic, M.D. Extracorporeal photopheresis (ECP) is an effective, low-risk immunomodulating therapy for leukemic cutaneous T cell lymphoma (L-CTCL) and graft versus host disease (GVHD), but whether the mechanism(s) of action in these two diseases is (are) identical or different is unclear. To determine the effects of ECP in vivo, we studied regulatory T cells (T-regs), cytotoxic T lymphocytes (CTLs), and dendritic cells (DCs) by immunofluorescence flow cytometry in 18 L-CTCL and 11 GVHD patients before and after ECP at Day 2, 1 month, 3 months, and 6 months. In this study, ECP was effective in 12/18 L-CTCL patients with a 66.7% overall response rate (ORR) and 6/11 GVHD patients with a 54.5% ORR. Prior to ECP, the percentages of CD4+Foxp3+ T cells in 9 L-CTCL patients were either lower (L-CTCL-Low, n=2) or higher (L-CTCL-High, n=7) than normal. Five of the 7 GVHD patients had high percentages of CD4+Foxp3+ T cells (GVHD-High). Six of 7 L-CTCL-High patients had >80% CD4+Foxp3+ T cells which were correlated with tumor cells, and were responders. Both L-CTCL-High and GVHD-High patients had decreased percentages of CD4+Foxp3+ and CD4+Foxp3+CD25- T cells after 3 months of treatment. CD4+Foxp3+CD25+ T cells increased in GVHD-High patients but decreased in L-CTCL-High patients after 3 months of ECP. In addition, numbers of CTLs were abnormal. We confirmed that numbers of CTLs were low in L-CTCL patients, but high in GVHD patients prior to ECP. After ECP, CTLs increased after 1 month in 4/6 L-CTCL patients whereas CTLs decreased after 6 months in 3/3 GVHD patients. Myeloid (mDCs) and plasmacytoid DCs (pDCs) were also low at baseline in L-CTCL and GVHD patients confirming the DC defect. After 6 months of ECP, numbers and percentages of mDCs and pDCs increased in L-CTCL and GVHD. MDCs were favorably increased in 8/12 L-CTCL responders whereas pDCs were favorably increased in GVHD patients. These data suggest that ECP is favorably modulating the DC subsets. In L-CTCL patients, the mDCs may orchestrate Th1 cell responses to overcome immune suppression and facilitate disease regression. However, in GVHD patients, ECP is favorably down-regulating the immune system and may be facilitating immune tolerance to auto-or allo-antigens. In both L-CTCL and GVHD patients, DCs are modulated, but the T cell responses orchestrated by the DCs are different, suggesting that ECP modulates depending on the immune milieu. _______________

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Autophagy is an evolutionarily conserved process that functions to maintain homeostasis and provides energy during nutrient deprivation and environmental stresses for the survival of cells by delivering cytoplasmic contents to the lysosomes for recycling and energy generation. Dysregulation of this process has been linked to human diseases including immune disorders, neurodegenerative muscular diseases and cancer. Autophagy is a double edged sword in that it has both pro-survival and pro-death roles in cancer cells. Its cancer suppressive roles include the clearance of damaged organelles, which could otherwise lead to inflammation and therefore promote tumorigenesis. In its pro-survival role, autophagy allows cancer cells to overcome cytotoxic stresses generated the cancer environment or cancer treatments such as chemotherapy and evade cell death. A better understanding of how drugs that perturb autophagy affect cancer cell signaling is of critical importance toimprove the cancer treatment arsenal. In order to gain insights in the relationship between autophagy and drug treatments, we conducted a high-throughput drug screen to identify autophagy modulators. Our high-throughput screen utilized image based fluorescent microscopy for single cell analysis to identify chemical perturbants of the autophagic process. Phenothiazines emerged as the largest family of drugs that alter the autophagic process by increasing LC3-II punctae levels in different cancer cell lines. In addition, we observed multiple biological effects in cancer cells treated with phenothiazines. Those antitumorigenic effects include decreased cell migration, cell viability, and ATP production along with abortive autophagy. Our studies highlight the potential role of phenothiazines as agents for combinational therapy with other chemotherapeutic agents in the treatment of different cancers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Non-melanoma skin cancer (NMSC) is the most frequently diagnosed form of cancer in United States. As in many other cancers, this slow growing malignancy manifests deregulated expression of apoptosis regulating proteins including bcl-2 family member proteins. To understand the role of apoptosis regulating protein in epidermal homeostasis and progression of NMSC, we investigated keratinocyte proliferation, differentiation and tumorigenesis in bcl-2 and bax null mice. The rate and the pattern of proliferation and spontaneous cell death were the same between the null and the control mice. Both bcl-2 and bax null epidermis showed decreased levels of cytokeratin 14 expression compared to the control littermates. Also, the gene knock out mice showed higher expression of cytokeratin 1 and loricrin in epidermis compared to the control mice. The apoptotic response to genotoxic agent, UV radiation (UVR), was assessed by counting sunburn cells. The bax null keratinocytes showed a resistance to apoptosis while bcl-2 null mice showed an increased susceptibility to cell death compared to the control mice. Moreover, we demonstrated an increase in tumor incidence in bax null mice compared to control littermates in the in vivo chemical carcinogenesis study. Next, we examined the tumor suppressor role of bax protein in NMSC by studying its participation in repair of UVR-mediated DNA lesions. In UVR treated primary keratinocytes from bax deficient mice, the level of CPD remaining was twice that of control cells at 48 hours. Similar results were obtained using embryonic fibroblasts from bax null and bax +/+ embryos, and also with a bax deficient prostate cancer cell line in which bax expression had been restored. However, the repair rate of 6-4 PP was unaffected by the absence of bax protein in all three of above mentioned cell types. In conclusion, bax protein may have a dual function in its role as tumor suppressor in NMSC. Bax may directly or indirectly facilitate DNA repair, or programmed cell death if DNA damage is too severe, thus, in either function, preserving genomic integrity following a genotoxic event. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The essential p21-activated kinase (PAK), Shk1, is a critical component of a Ras/Cdc42/PAK complex required for cell viability, normal cell polarity, proper regulation of cytoskeletal dynamics, and sexual differentiation in the fission yeast, Schizosaccharomyces pombe. While cellular functions of PAKs have been described in eukaryotes from yeasts to mammals, the molecular mechanisms of PAK regulation and function are poorly understood. This study has characterized a novel Shk1 inhibitor, Skb15, and, in addition, identified the cell polarity regulator, Tea1, as a potential biological substrate of Shk1 in S. pombe. Skb15 is a highly conserved WD repeat protein that was discovered from a two-hybrid screen for proteins that interact with the catalytic domain of Shk1. Molecular data indicate that Skb15 negatively regulates Shk1 kinase activity in S. pombe cells. A null mutation in the skb15 gene is lethal and results in deregulation of actin polymerization and localization, microtubule biogenesis, and the cytokinetic machinery, as well as a substantial uncoupling of these processes from the cell cycle. Loss of Skb15 function is suppressed by partial loss of Shk1, demonstrating that negative regulation of Shk1 by Skb15 is required for proper execution of cytoskeletal remodeling and cytokinetic functions. A mouse homolog of Skb15 can substitute for its counterpart in fission yeast, demonstrating that Skb15 protein function has been substantially conserved through evolution. ^ Our laboratory has recently demonstrated that Shk1, in addition to regulating actin cytoskeletal organization, is required for proper regulation of microtubule dynamics in S. pombe cells. The Shk1 protein localizes to interphase and mitotic microtubules, the septum-forming region, and cell ends. This pattern of localization overlaps with that of the cell polarity regulator, Tea1, in S. pombe cells. The tea1 gene was identified by Paul Nurse's laboratory from a screen for genes involved in the control of cell morphogenesis in S. pombe. In contrast to wild type S. pombe cells, which are rod shaped, tea1 null cells are often bent and/or branched in shape. The Tea1 protein localizes to the cell ends, like Shk1, and the growing tips of interphase microtubules. Thus, experiments were performed to investigate whether Tea1 interacts with Shk1. The tea1 null mutation strongly suppresses the loss of function of Skb15, an essential inhibitor of Shk1 function. All defects associated with the skb15 mutation, including defects in F-actin organization, septation, spindle elongation, and chromosome segregation, are suppressed by tea1Δ, suggesting that Tea1 may function in these diverse processes. Consistent with a role for Tea1 in cytokinesis, tea1Δ cells have a modest cell separation defect that is greatly exacerbated by a shk1 mutation and, like Shk1, Tea1 localizes to the septation site. Molecular analyses showed that Tea1 phosphorylation is significantly dependent on Shk1 function in vivo and that bacterially expressed Tea1 protein is directly phosphorylated by recombinant Shk1 kinase in vitro. Taken together, these results identify Tea1 as a potential biological substrate of Shk1 in S. pombe. ^ In summary, this study provides new insights into a conserved regulatory mechanism for PAKs, and also begins to uncover the molecular mechanisms by which the Ras/Cdc42/PAK complex regulates the microtubule and actin cytoskeletons and cell growth polarization in fission yeast. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To assess the effect of deregulated Ha-ras and bcl-2, individually and in combination on epidermal keratinocyte homeostasis and during multistep skin carcinogenesis, we generated skin-specific transgenic mice and keratinocyte transfectants constitutively expressing oncogenic Ha-ras and bcl-2 proteins. The deregulated Ha-ras and bcl-2 expression contributing to homeostatic imbalances in the skin had an additive effect on the probability of tumor development. They were also cooperative in incidence, growth, and latency of tumor formation, and they exhibited synergistic cooperation in malignant transformation of benign papillomas. To explain the homeostatic imbalances by Ha-ras and bcl-2 overexpression in the skin, we investigated the three major cellular processes of proliferation, cell death, and differentiation. Epidermal expression of Bcl-2 retarded keratinocyte proliferation in the epidermis of neonatal mice compared with results for control littermates. Constitutive expression of Ha-ras increased keratinocyte proliferation, and co-expression of bcl-2 modestly suppressed the ras-mediated abnormal proliferation of neonatal keratinocytes. Bcl-2 proteins in keratinocytes protected UV-treated cells from apoptotic cell death regardless of oncogenic ras expression in both non-neoplastic neonatal epidermis and human keratinocyte cell lines. The spontaneous apoptotic index (AI) was also lower in papillomas constitutively expressing bcl-2 compared with the ones that developed in control mice. Ras-overexpressing epidermis, including that in ras/bcl-2 double transgenic mice, had abnormal differentiation patterns compared with controls. The oncogenic ras protein had alterations in both epidermal distribution and the extent of cytokeratin 14 and involucrin expression. Abnormal expression of the hyperproliferation marker cytokeratin 6 and modest down regulation of cytokeratin 1 were also detected. Late appearance of filaggrin was another abnormal phenotype of the ras-expressing epidermis. Overexpression of bcl-2 had no effect on epidermal differentiation. Together, these findings suggest that constitutive expression of oncogenic Ha-ras and bcl-2 are important determinants of epidermal proliferation, viability and differentiation. In summary, our results demonstrated that the disruption of epidermal homeostasis by overexpressed ras and bcl-2 predisposes to hyperplastic growth of the epidermis and to papilloma development and that these proteins with distinct mechanisms for oncogenesis are functionally synergistic for malignant transformation of chemically induced skin carcinogenesis. ^