A mechanism of insulin-like growth factor binding protein 2-induced cell mobility in glioma

Insulin-like growth factor binding protein 2 (IGFBP2) is a protein known to be overexpressed in a majority of glioblastoma multiforme (GBM) tumors. While it is known the IGFBP2 is involved in promoting GBM tumor cell invasion, no mechanism exists for how the protein is involved in signal transduction pathways leading to enhanced cell invasion. ^ We follow up on preliminary microarray data on IGFBP2-overexpressing GBM cells and protein sequence analysis of IGFBP2 in generating the hypothesis that IGFBP2 interacts with integnn α5 in regulating cell mobility. Microarray data showing upregulation of integrin α5 by IGFBP2 is validated and evidence of protein-protein interaction between IGFBP2 and integrin α5 is found. The exact binding domain on IGFBP2 responsible for its interaction with integrin α5 is also determined, confirming our initial findings and reaffirming that the IGFBP2/integrin α5 interaction is specific. Disruption of this interaction resulted in attenuation of IGFBP2-enhanced cell mobility. Further, we found that cell mobility is only enhanced when IGFBP2 and integrin α5 are both overexpressed and able to interact with each other. ^ We also determined fibronectin to be a critical player in the activation of the IGFBP2/integrin α5 pathway. The activation of this pathway appears to be progressive and initiates once GBM cells have sufficiently established anchorage. ^

MOLECULAR AND GENOMIC BASED INSIGHTS INTO THE EVOLUTION OF ENTEROCOCCUS FAECIUM FROM COMMENSAL TO HOSPITAL-ADAPTED PATHOGEN

The basis for the recent transition of Enterococcus faecium from a primarily commensal organism to one of the leading causes of hospital-acquired infections in the United States is not yet understood. To address this, the first part of my project assessed isolates from early outbreaks in the USA and South America using sequence analysis, colony hybridizations, and minimal inhibitory concentrations (MICs) which showed clinical isolates possess virulence and antibiotic resistance determinants that are less abundant or lacking in community isolates. I also revealed that the level of ampicillin resistance increased over time in clinical strains. By sequencing the pbp5 gene, I demonstrated an ~5% difference in the pbp5 gene between strains with MICs <4ug/ml and those with MICs >4µg/ml, but no specific sequence changes correlated with increases in MICs within the latter group. A 3-10% nucleotide difference was also seen in three other genes analyzed, which suggested the existence of two distinct subpopulations of E. faecium. This led to the second part of my project analyzing concatenated core gene sequences, SNPs, the 16S rRNA, and phylogenetics of 21 E. faecium genomes confirming two distinct clades; a community-associated (CA) clade and hospital-associated (HA) clade. Molecular clock calculations indicate that these two clades likely diverged ~ 300,000 to > 1 million years ago, long before the modern antibiotic era. Genomic analysis also showed that, in addition to core genomic differences, HA E. faecium harbor specific accessory genetic elements that may confer selection advantages over CA E. faecium. The third part of my project discovered 6 E. faecium genes with the newly identified “WxL” domain. My analyses, using RT-PCR, western blots, patient sera, whole-cell ELISA, and immunogold electron microscopy, indicated that E. faecium WxL genes exist in operons, encode bacterial cell surface localized proteins, that WxL proteins are antigenic in humans, and are more exposed on the surface of clinical isolates versus community isolates (even though they are ubiquitous in both clades). ELISAs and BIAcore analyses also showed that proteins encoded by these operons bind several different host extracellular matrix proteins, as well as to each other, suggesting a novel cell-surface complex. In summary, my studies provide new insights into the evolution of E. faecium by showing that there are two distantly related clades; one being more successful in the hospital setting. My studies also identified operons encoding WxL proteins whose characteristics could also contribute to colonization and virulence within this species.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Specificity of somatostatin receptor and G -protein interactions as characterized by somatostatin receptor subtype specific antibodies

The neuropeptide somatostatin is a widely distributed general inhibitor of endocrine, exocrine, gastrointestinal and neural functions. The biological actions of somatostatin are initiated by interaction with high affinity, plasma membrane somatostatin receptors (sst receptors). Five sst receptor subtypes have been cloned and sequence analysis shows they are all members of the G protein coupled receptor superfamily. The G proteins play a pivotal role in sst receptor signal transduction and the specificity of somatostatin receptor-G protein coupling defines the possible range of cellular responses. However, the data for endogenous sst receptor and G protein coupling is very limited, and even when it is available, the sst receptor subtypes involved in G protein coupling and signal transduction are unknown due to the expression of multiple sst receptor subtypes in target cell lines or tissues of somatostatin.^ In an effort to characterize each individual sst receptor subtypes, antisera against unique C-terminal regions of different sst receptor subtypes have been developed in our lab. In this report, antisera made against the sst1, sst2A and sst4 receptors are characterized. They are highly specific to their corresponding receptors and efficiently immunoprecipitate the sst receptors. Using these antibodies, the cell lines expressing these sst receptor subtypes were identified with both immunoprecipitation and Western blot methods. The development of sst receptor subtype specific antibodies make it possible to determine the specificity of the sst receptor subtype and G protein coupling in target cells or tissues expressing multiple sst receptors, two questions were addressed by this thesis: (1) whether different cellular environments affect receptor subtype and G protein coupling; (2) whether different sst receptors couple to different G proteins in similar cellular environments.^ Taken together our findings, both sst1 and sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells, G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in GH$\sb4$C$\sb1$ cells. Further, sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in AR4-2J cells while sst4 receptors couple with G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells. Therefore, the G protein coupling of the same sst receptors in different cell lines is basically similar in that they all couple with multiple $\alpha$-subunits of the G$\rm \sb{i}$ proteins, suggesting cellular environment has little effect on receptor and G protein coupling. Moreover, different sst receptors have similar G protein coupling specificities in the same cell line, suggesting components other than receptor and G$\alpha$ subunits in the signal transduction pathways may contribute to specific functions of each sst receptor subtype. This series of experiments represent a novel approach in dissecting signal transduction pathways and may have general application in the field. Furthermore, this is the first systematic study of sst receptor subtype and G protein $\alpha$-subunit interaction in both transfected cells and in normal cell lines. The information generated will be very useful in our understanding of sst receptor signal transduction pathways and in directing future sst receptor research. ^

ATXA -dependent gene expression in Bacillus anthracis

The Bacillus anthracis toxin genes, cya, lef , and pag, can be viewed as a regulon, in which transcription of all three genes is activated in trans by the same regulatory gene, atxA, in response to the same signal, CO2. I determined that several phenotypes are associated with the atxA gene. In addition to being toxin-deficient, an atxA -null mutant grows poorly on minimal media and sporulates early compared to the parent strain. Furthermore, an atxA-null mutant has an altered 2-D gel protein profile. I used a genetic approach to find additional atxA-regulated genes. Random transcriptional lacZ fusions were generated in B. anthracis using transposon Tn 917-LTV3. Transposon-insertion libraries were screened for mutants expressing increased β-galactosidase activity in 5% CO2. Introduction of an atxA-null mutation in these mutants revealed that 79% of the CO2-regulated fusions were also atxA-dependent. DNA sequence analysis of transposon insertion sites in mutants carrying CO 2/atxA-regulated fusions revealed ten mutants harboring transposon insertions in loci distinct from the toxin genes. The majority of the tcr (toxin co-regulated) loci mapped within the pXO1 pathogenicity island. These results indicate a clear association of atxA with CO2-enhanced gene expression in B. anthracis and provide evidence that atxA regulates genes other than the structural genes for the anthrax toxin proteins. ^ Characterization of one tcr locus revealed a new regulatory gene, pagR. The pagR gene (300 nt) is located downstream of pag. pagR is cotranscribed with pag and is responsible for autogenous control of the operon. pagR also represses expression of cya and lef. Repression of toxin gene expression by pagR may be mediated by atxA. The steady state level of atxA mRNA is increased in a pagR mutant. Recombinant PagR protein purified from Escherichia coli did not specifically bind the promoter regions of pagA or atxA. An unidentified factor in B. anthracis crude extracts, however, was able to bind the atxA promoter in the absence of PagR or AtxA. These investigations increase our knowledge of virulence regulation in B. anthracis and ultimately will lead to a better understanding of anthrax disease. ^

Constitutively active cAMP receptor mutants dominantly inhibit receptor-mediated signaling pathways in Dictyostelium discoideum

Dictyostelium, a soil amoeba, is able to develop from free-living cells to multicellular fruiting bodies upon starvation using extracellular cAMP to mediate cell-cell communication, chemotaxis and developmental gene expression. The seven transmembrane G protein-coupled cAMP receptor-1 (cAR1) mediated responses, such as the activation of adenylyl cyclase and guanylyl cyclase, are transient, due to the existence of poorly understood adaptation mechanisms. For this dissertation, the powerful genetics of the Dictyostelium system was employed to study the adaptation mechanism of cAR1-mediated cAMP signaling as well as mechanisms intrinsic to cAR1 that regulate its activation. ^ We proposed that constitutively active cAR1 would cause constant adaptation, thus inhibiting downstream pathways that are essential for aggregation and development. Therefore, a screen for dominant negative cAR1 mutants was undertaken to identify constitutively active receptor mutants. Three dominant negative cAR1 mutants were identified. All appear to be constitutively active receptor mutants because they are constitutively phosphorylated and possess high affinity for cAMP. Biochemical studies showed that these mutant receptors prevented the activation of downstream effectors, including adenylyl and guanylyl cyclases. In addition, these cells also were defective in cAMP chemotaxis and cAR1-mediated gene expression. These findings suggest that the mutant receptors block development by constantly activating multiple adaptation pathways. ^ Sequence analysis revealed that these mutations (I104N, L100H) are clustered in a conserved region of the third transmembrane helix (TM3) of cAR1. To investigate the role of this region in receptor activation, one of these residues, I104, was mutated to all the other 19 possible amino acids. We found that all but the most conservative substitutions increase the receptor's affinity about 20- to 70-fold. However, only highly polar substitutions of I104, particularly basic residues, resulted in receptors that are constitutively phosphorylated and dominantly inhibit development, suggesting that highly polar substitutions not only disrupt an interaction constraining the receptor in its low-affinity, inactive state but also promote an additional conformational change that resembles the ligand-bound conformation. Our findings suggest that I104 plays a specific role in constraining the receptor in its inactive state and that substituting it with highly polar residues results in constitutive activation. ^

Characterization of the NOP -1 opsin photoreceptor in the filamentous fungus Neurospora crassa

Light absorption is an important process for energy production and sensory perception in many organisms. In the filamentous fungus, Neurospora crassa, blue-light is an important regulator of both asexual and sexual development, but the identity of the blue-light receptor is unknown. The work presented in this dissertation initiated the characterization of the putative N. crassa opsin photoreceptor, NOP-1. Opsins were thought to exist only in the archaea and mammals until the discovery of nop-1. All opsins have the same conserved structure of seven transmembrane helical domains with a lysine residue in the seventh helix specific for forming a Schiff-base linkage with retinal. The predicted NOP-1 protein sequence is equally similar to archaeal rhodopsins and a newly identified fungal opsin-related protein group (ORPs). ORPs maintain the seven transmembrane helical structure of opsins, but lack the conserved lysine residue for binding retinal. An ORP gene, orp-1 was identified in N. crassa and this work includes the cloning and sequence analysis of this gene. Characterization of NOP-1 function in N. crassa development began with the construction of a Δnop-1 deletion mutant. Extensive phenotypic analysis of Δnop-1 mutants revealed only subtle defects during development primarily under environmental conditions that induce a stress response. NOP-1 was overexpressed in the heterologous system Pichia pastoris, and it was demonstrated that NOP-1 protein bound all-trans retinal to form a green-light absorbing pigment (λmax = 534 nm) with a photochemical reaction cycle similar to archaeal sensory rhodopsins. nop-1 gene expression was monitored during N. crassa development. nop-1 transcript is highly expressed during asexual sporulation (conidiation) and transcript levels are abundant in the later stages of conidial development. nop-1 expression is not regulated by blue-light or elevated temperatures. Potential functions for NOP-1 were discovered through the transcriptional analysis of conidiation-associated genes in Δnop-1 mutants. NOP-1 exhibits antagonistic transcriptional regulation of conidiation-associated genes late in conidial development, by enhancing the carotenogenic gene, al-2 and repressing the conidiation-specific genes, con-10 and con-13. ^