45 resultados para Dominant-negative Mutant
Resumo:
The canonical and non-canonical Wnt signaling pathways appear to interact with one another as a network in development, or when hyper-activated, in the progression of disease. A much studied key mediator of the canonical Wnt pathway, β-catenin, is characterized by a central armadillo-repeat domain that engages in multiple protein-protein interactions, such as those with cadherins functioning at cell-cell contact regions. In the nucleus, β-catenin forms a complex with the repressor TCF/LEF, promoting the activation of genes participating in processes such as proliferation, differentiation and stem cell survival. Somewhat similarly, the p120-catenin binds the distinct transcriptional repressor Kaiso, relieving Kaiso-mediated repression to promote gene activation. Here, employing Xenopus laevis, I report upon both downstream and upstream aspects of the p120-catenin/Kaiso pathway which was previously poorly understood. I first show that Kaiso, a BTB/POZ zinc-finger family member, directly represses canonical Wnt gene targets (Siamois, c-Fos, Cyclin-D1 and c-Myc) in conjunction with TCF. Depletion or dominant-negative inhibition of xKaiso results in Siamois de-repression, while xKaiso over-expression induces additional Siamois repression through recruitment of N-CoR co-repressor and chromatin modifications. Functional interdependencies are further corroborated by the capacity of Kaiso to suppress β-catenin-induced axis duplication. Thus, my work inter-relates the p120-catenin/Kaiso and β-catenin/TCF pathways at the level of specific gene promoters important in development and cancer progression. Regarding upstream aspects of the p120-catenin/Kaiso pathway, I collaboratively identified p120 in association with Frodo, a protein previously identified as a component of the canonical (β-catenin dependent) Wnt pathway. I determined that canonical Wnt signals result in Frodo-mediated stabilization of p120-catenin, resulting in the sequestration of Kaiso to the cytoplasm and thereby the activation (relief of repression) of gene targets. Developmental evidence supporting this view included findings that Frodo has the capacity to partially rescue Kaiso over-expression phenotypes in early Xenopus embryos. Taken together, my studies point to the convergence of p120-catenin/Kaiso and β-catenin/TCF signaling pathways at the level of gene transcription as well as at more upstream points during vertebrate development. ^
Resumo:
Translation termination as a result of premature nonsense codon-incorporation in a RNA transcript can lead to the production of aberrant proteins with gain-of-function or dominant negative properties that could have deletrious effects on the cell. T-cell Receptor (TCR) genes acquire premature termination codons two-thirds of the time as a result of the error-prone programmed rearrangement events that normally occur during T-cell development. My studies have focused on the fate of TCR precursor mRNAs in response to in-frame nonsense mutations. ^ Previous published studies from our laboratory have shown that TCR precursor mRNAs are subject to nonsense mediated upregulation of pre-mRNA (NMUP). In this dissertation, I performed substitution and deletion analysis to characterize specific regions of TCR which are required to elicit NMUP. I performed frame- and factor-dependence studies to determine its relationship with other nonsense codon induced responses using several approaches including (i) translation dependence studies (ii) deletion and mutational analysis, as well as (iii) siRNA mediated knockdown of proteins involved. I also addressed the underlying molecular mechanism for this pre-mRNA upregulation by (i) RNA half-life studies using a c-fos inducible promoter, and (ii) a variety of assays to determine pre-mRNA splicing efficiency. ^ Using these approaches, I have identified a region of TCR that is both necessary and sufficient to elicit (NMUP). I have also found that neither cytoplasmic translation machinery nor the protein UPF1 are involved in eliciting this nuclear event. I have shown that the NMUP can be induced not only by nonsense and frameshift mutations, but also missense mutations that disrupt a cis splicing element in the exon that contains the mutation. However, the effect of nonsense mutations on pre-mRNA is unique and distinguishable from that of missense mutations in that nonsense mutations can upregulate pre-mRNA in a frame-dependent manner. Lastly, I provide evidence that NMUP occurs by a mechanism in which nonsense mutations inhibit the splicing of introns. In summary, I have found that TCR precursor mRNAs are subject to multiple forces involving both RNA splicing and translation that can either increase or decrease the levels of these precursor mRNAs. ^
Resumo:
4HPR is a synthetic retinoid that has shown chemopreventive and therapeutic efficacy against premalignant and malignant lesions including oral leukoplakia, ovarian and breast cancer, and neuroblastoma. 4HPR induces apoptosis in various cancer cells and production of reactive oxygen species (ROS) has been suggested as a possible cause underlying these effects. However, the mechanisms governing these effects by 4HPR are not fully elucidated. In this study, we explored the mechanisms of 4HPR-induced ROS increase and apoptosis in human cancer cells. ^ First, we identified genes modulated by 4HPR using oligonucleotide gene expression arrays and found that they fall into specific functional canonical pathways and gene networks using Ingenuity Pathways Analysis®. Further analysis has shown that 4HPR induced up-regulation of Endoplasmic Reticulum (ER)-related genes such as Heat shock proteins 70 and 90 and the transcriptional factor, GADD153. These findings were validated using quantitative real-time PCR. ^ Second, we found that 4HPR induced extensive ER stress evidenced by dilation of the ER and endoribonuclease-mediated splicing and activation of the transcriptional factor, XBP-1. In addition, 4HPR induced the up-regulation of various ER stress-related genes and their protein products, as well as cleavage and activation of the ER specific Caspase-4. Concomitantly with XBP-1 splicing, all of these effects were dependent on ROS generation by 4HPR. Furthermore, chemical inhibition and RNA interference studies revealed a novel pro-apoptotic role for HSP70/A1A in 4HPR-mediated apoptosis. ^ Third, we observed rapid activation of the small GTPase Rac by 4HPR which was upstream of ROS generation. Inhibition of Rac activity or silencing of its expression by RNA interference inhibited ROS generation and apoptosis induction by 4HPR. siRNA targeting PAK1 and expression of a dominant negative Rac, decreased 4HPR-mediated ROS generation, while expression of a constitutive active Rac increased basal and 4HPR-induced ROS generation and PARP cleavage. Furthermore, metastatic cancer cells exhibited higher Rac activation, ROS generation, and cell growth inhibition due to 4HPR exposure compared to their primary cancer cell counterparts. ^ These findings provide novel insights into 4HPR-mediated ROS generation and apoptosis induction and support the use of ROS inducing agents such as 4HPR against metastatic cancer cells. ^
Resumo:
Adenylyl cyclase (AC) converts ATP into cAMP, which activates protein kinase A (PKA). Activation of PKA leads to the phosphorylation of specific substrates. The mechanism of specificity of PKA phosphorylation baffled researchers for many years. The discovery of A Kinase Anchoring Proteins (AKAPs) has helped to unravel this mystery. AKAPs function to target PKA to specific regions within the cell. They also anchor other enzymes, receptors, or channels leading to tightly regulated signaling modules. Several studies have suggested an important role for activated PKA in these complexes, including the AKAPs yotiao and muscle AKAP (mAKAP). Yotiao, a plasma membrane AKAP, anchors PP1, NMDA receptors, IP3 receptors, and heart potassium channel subunit KCNQI. PKA phosphorylation of NMDA receptors as well as KCNQI leads to increased channel activity. Patients with mutations in KCNQI or yotiao that cause loss of targeting of KCNQI develop long QT syndrome, which can be fatal. mAKAP anchors several CAMP/PKA-regulated pathways to the nuclear envelope in cardiac myocytes. The necessity of activated PKA in these complexes led to the hypothesis that AC is also anchored. The results indicate that AC does associate with yotiao in brain and heart, specifically with AC types I-III, and IX. Co-expression of AC II or III with yotiao leads to inhibition of each isoform's activity. Binding assays revealed that yotiao binds to the N-terminus of AC II and that this region can reverse the inhibition of AC II, but not AC III, indicating unique binding sites on yotiao. AC II binds directly to as 808-957 of yotiao. Y808-957 acts as a dominant negative as the addition of it to rat brain membranes results in a ∼40% increase in AC activity. Additionally, AC was also found to associate with mAKAP in heart, specifically with AC types II and V. The binding site of AC was mapped to 275-340 of mAKAP, while mAKAP binds to the soluble domains of AC V as a complex. These results indicate that interactions between AC and AKAPs are specific and that AC plays an important role in AKAP-targeted signaling. ^
Resumo:
Increased glycolysis and oxidative stress are common features of cancer cells. These metabolic alterations are associated with mitochondrial dysfunction and can be caused by mitochondrial DNA (mtDNA) mutations, oncogenic signals, loss of tumor suppressor, and tumor tissue hypoxia. It is well established that mitochondria play central roles in energy metabolism, maintenance of redox balance, and regulation of apoptosis. However, the biochemical and molecular mechanisms that maintain high glycolysis in cancer cells (the Warburg effect) with mitochondrial dysfunction and oxidative stress remain to be determined. The major goals of this study were to establish a unique experimental system in which the mitochondrial respiratory function can be regulated as desired, and to use this system to investigate the mechanistic link between mitochondrial dysfunction and the Warburg effect along with oxidative stress in cancer cells. To achieve these goals, I have established a tetracycline-inducible system in which a dominant negative form of mitochondrial DNA polymerase y (POLGdn) expression could be regulated by tetracycline; thus controlling mitochondrial respiratory function. Using this cell system, I demonstrated that POLGdn expression resulted in mitochondrial dysfunction through decreasing mtDNA content, depletion of mtDNA encoded mRNA and protein expression. This process was mediated by TFAM proteasome degradation. Mitochondrial dysfunction mediated by POLGdn expression led to a significant increase in cellular glycolysis and oxidative stress. Surprisingly, mitochondrial dysfunction also resulted in increased NAD(P)H oxidase (NOX) enzyme activity, which was shown to be essential for maintaining high glycolysis. Chemical Inhibition of NOX activity by diphenyliodonium (DPI) preferentially impacted the survival of mitochondrial defective cells. The colon cancer HCT116-/- cells that have lost transcriptional regulation of the mitochondrial assembling enzyme SCO2, leading to compromised mitochondrial respiratory function, were found to have increased NOX activity and were highly sensitive to DPI treatment. Ovarian epithelial cells with Ras transformation also exhibited an increase in NOX gene expression and NOX enzyme activity, rendering the cells sensitive to DPI inhibition especially under hypoxic condition. These data together suggest that NOX plays a novel role in maintaining high glycolysis in cancer cells with mitochondrial defects, and that NOX may be a potential target for cancer therapy. ^
Resumo:
Gastrointestinal Stromal Tumors (GIST) are sarcomas driven by gain-of-function mutations of KIT or PDGFRA. Although, the introduction of tyrosine kinase inhibitors has dramatically changed the history of this disease, evidences emerge that inhibition of KIT or PDGFRA are not sufficient to cure patients. The developmental pathway Notch has a critical role in the cell fate, regulating cell proliferation and differentiation. Dysregulation of Notch pathway has been implicated in a wide variety of cancers functioning as a tumor promoter or a tumor suppressor in a cell context dependent manner. Given that Notch activation deregulates the morphogenesis of mesenchymal cells in the GI track, that Notch acts as a tumor suppressor in neuroendocrine tumors, and finally that the cell of origin of GIST are the Interstitial Cell of Cajal that arise from a mesenchymal origin with some neuroendocrine features, we hypothesized that Notch pathway signaling may play a role in growth, survival and differentiation of GIST cells. To test this hypothesis, we genetically and pharmacologically manipulated the Notch pathway in human GIST cells. In this study, we demonstrated that constitutively active intracellular domain of Notch1 (ICN-1) expression potently induced growth arrest and downregulated KIT expression. We have performed a retrospective analysis of 15 primary GIST patients and found that high mRNA level of Hes1, a major target gene of Notch pathway, correlated with a significantly longer relapse-free survival. Therefore, we have established that treatment with the FDA approved histone deacetylase inhibitor SAHA (Vorinostat) caused dose-dependent upregulation of Notch1 expression and a parallel decrease in viability in these cells. Retroviral silencing of downstream targets of Notch with dominant negative Hes-1 as well as pharmacological inhibition of Notch pathway with a γ-secretase inhibitor partially rescued GIST cells from SAHA treatment. Taken together these results identify anti-tumor effect of Notch1 and a negative cross-talk between Notch1 and KIT pathways in GIST. Consequently, we propose that activation of this pathway with HDAC inhibitors may be a potential therapeutic strategy for GIST patients.
Resumo:
Many eukaryotic promoters contain a CCAAT element at a site close ($-$80 to $-$120) to the transcription initiation site. CBF (CCAAT Binding Factor), also called NF-Y and CP1, was initially identified as a transcription factor binding to such sites in the promoters of the Type I collagen, albumin and MHC class II genes. CBF is a heteromeric transcription factor and purification and cloning of two of the subunits, CBF-A and CBF-B revealed that it was evolutionarily conserved with striking sequence identities with the yeast polypeptides HAP3 and HAP2, which are components of a CCAAT binding factor in yeast. Recombinant CBF-A and CBF-B however failed to bind to DNA containing CCAAT sequences. Biochemical experiments led to the identification of a third subunit, CBF-C which co-purified with CBF-A and complemented the DNA binding of recombinant CBF-A and CBF-B. We have recently isolated CBF-C cDNAs and have shown that bacterially expressed purified CBF-C binds to CCAAT containing DNA in the presence of recombinant CBF-A and CBF-B. Our experiments also show that a single molecule each of all the three subunits are present in the protein-DNA complex. Interestingly, CBF-C is also evolutionarily conserved and the conserved domain between CBF-C and its yeast homolog HAP5 is sufficient for CBF-C activity. Using GST-pulldown experiments we have demonstrated the existence of protein-protein interaction between CBF-A and CBF-C in the absence of CBF-B and DNA. CBF-B on other hand, requires both CBF-A and CBF-C to form a ternary complex which then binds to DNA. Mutational studies of CBF-A have revealed different domains of the protein which are involved in CBF-C interaction and CBF-B interaction. In addition, CBF-A harbors a domain which is involved in DNA recognition along with CBF-B. Dominant negative analogs of CBF-A have also substantiated our initial observation of assembly of CBF subunits. Our studies define a novel DNA binding structure of heterotrimeric CBF, where the three subunits of CBF follow a particular pathway of assembly of subunits that leads to CBF binding to DNA and activating transcription. ^
Resumo:
The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^
Resumo:
A Western Array Screening system in conjunction with an in vitro lung carcinogenesis model, which consists of human bronchial epithelial (HBE) cells representing normal (NHBE), immortalized (BEAS-2B and 1799), transformed (1198), and tumorigenic (1170-I) was used to test the hypothesis that lung carcinogenesis involves specific changes in signaling proteins. Forty six proteins whose expression was upregulated by >2 fold and 23 proteins whose expression was downregulated by >2 fold in 1170-I compared to NHBE cells were identified. The levels of six proteins including bFGF (both intracellular and secreted), Akt and p70s6K in the PI3KJp70s6K pathway and the bFGF receptor (FGFR1) were upregulated in different stages of lung carcinogenesis. Akt activity and phospho-p70s6K were also increased in 1170-I compared to NHBE cells, suggesting that PI3K/p70s6K pathway is activated during lung carcinogenesis. bFGF treatment stimulated the growth of the 1170-I cells. Both tyrosine phosphorylation of FGFR1 and cell growth were inhibited in 1170-I cells after overexpression of dominant-negative(DN) FGFR1. Growth inhibition involved a G2 arrest related to decreased cdc2 activity, cdc25C downregulation, Wee1, p21(WAF1) and p27(Kip1) upregulation. Apoptosis was observed in tumorigenic but not in normal cells after overexpression of DNFGFR1. Confluent NHBE cells, were much less sensitive to the growth inhibition by DNFGFR1 compared to other cell lines analyzed. bFGF increased phospho-Akt and phospho-p70s6K in 1170-I cells. The Akt inhibitor LY294002 and the p70s6K inhibitor rapamycin inhibited bFGF-stimulated cell growth in 1170-I cells. Both agents downregulated the bFGF-induced increase in S phase by inducing G1 arrest. Also, LY294002 inhibited bFGF increased phospho-Akt, while both LY294002 and rapamycin inhibited bFGF increased phospho-p70s6K. Thus, cell proliferation stimulated by bFGF in 1170-I cells was at least partially mediated by PI3K/p70s6K pathway. Hsp90 was upregulated by bFGF in 1170-I cells. Its inhibitor geldanamycin inhibited the bFGF-stimulated growth via inducing apoptosis and G2 arrest through decreases in cdc2 expression/activity and p21 upregulation, and decreased Akt/phospho-Akt, p70s6K/phospho-p70s6K and Bad. Hsp90, p70s6K and Bad were found in the same complex, which may be important for signaling cell survival. Taken together, our study suggests that bFGF signaling, especially PI3K/p70s6K pathway, is important for lung carcinogenesis. ^
Resumo:
Nitric oxide is involved in a multitude of processes including regulation of vascular tone, neurotransmission, immunity, and cancer. Evidence suggests that nitric oxide exhibits anti-apoptotic activity in melanoma cells. Our laboratory showed that tumor expression of inducible nitric oxide synthase correlated strongly with poor survival in stage III and IV melanoma patients, suggesting an antagonistic role for nitric oxide in melanoma response to therapy. Therefore, the hypothesis that endogenously produced nitric oxide antagonizes chemotherapy-induced apoptosis was formed. Using cisplatin as a model for DNA damage in melanoma cell lines, the capacity of nitric oxide to regulate cell growth and apoptotic responses to cisplatin treatment was examined. The depletion of endogenously generated nitric oxide resulted in changes in cell cycle regulation and enhanced cisplatin-induced apoptosis in melanoma cells. Since nitric oxide was shown to be involved in the regulation of p53 stability, conformation and DNA binding activity, whether signaling through wild-type p53 in melanoma cells is regulated by nitric oxide was tested. Cisplatin-induced p53 accumulation and p21Waf1/Cip1/Sdi1 expression in nitric oxide-depleted melanoma cells were found to be strongly suppressed. When p53 binding to the p21Waf1/Cip1/Sdi1 promoter was examined, it was found that nitric oxide depletion significantly reduced the cisplatin-induced formation of p53-DNA complexes. These results suggest that nitric oxide is required for activation of wild-type p53 after DNA damage in melanoma cells. Finally, whether signaling through p53 controls melanoma response to DNA damage was examined. Transfection of a plasmid containing a dominant negative form of mutated p53 inhibited p21 Waf1/Cip1/Sdi1 expression and concomitantly enhanced apoptosis after cisplatin treatment. These data suggest that the induction of wild-type p53 protects melanoma cells against DNA damage via the up-regulation of p21 Waf1/Cip1/Sdi1. Together, these data strongly support the model that endogenous nitric oxide is required for p53 activation and p21Waf1/Cip1/Sdi1 expression after DNA damage, which can enhance melanoma resistance to therapy. Thus, in context of melanoma cells with wild-type p53 , low levels of endogenous constitutively-produced nitric oxide appear to facilitate the activation of p53 in response to DNA damage, thereby allowing for cell cycle arrest via p21Waf1/Cip1/Sdi1 induction, adequate DNA repair, and ultimately enhanced resistance to apoptosis. ^
Resumo:
The Armadillo family catenin proteins function in multiple capacities including cadherin-mediated cell-cell adhesion and nuclear signaling. The newest catenin, p120 catenin, differs from the classical catenins and binds to the membrane-proximal domain of cadherins. Recently, a novel transcription factor Kaiso was found to interact with p120 catenin, suggesting that p120 catenin also possesses a nuclear function. We isolated the Xenopus homolog of Kaiso, XKaiso, from a Xenopus stage 17 cDNA library. XKaiso contains an amino-terminal BTB/POZ domain and three carboxyl-terminal zinc fingers. The XKaiso transcript was present maternally and expressed throughout early embryonic development. XKaiso's spatial expression was defined via in situ hybridization and was found localized to the brain, eye, ear, branchial arches, and spinal cord. Co-immunoprecipitation of Xenopus p120 catenin and XKaiso demonstrated their mutual association, while related experiments employing differentially epitope-tagged XKaiso constructs suggest that XKaiso also self-associates. On the functional level, reporter assays employing a chimera of XKaiso fused to the GAL4 DNA binding domain indicated that XKaiso is a transcriptional repressor. To better understand the significance of the Kaiso-p120 catenin complex in vertebrate development, Kaiso knock-down experiments were undertaken, and the modulatory role of p120 catenin in Kaiso function examined during Xenopus development. Using morpholino antisense oligonucleotides to block translation of XKaiso, XKaiso was found to be essential for Xenopus gastrulation, being required for correct morphogenetic movements in early embryogenesis. Molecular marker analyses indicated that one target gene of the Wnt/β-catenin pathway, Siamois, is significantly increased in embryos depleted for XKaiso, while other dorsal, ventral, and mesodermal cell fate markers were unaltered. In addition, the non-canonical Wnt-11, known to participate in planar cell polarity/convergent extension processes, was significantly upregulated following depletion of XKaiso. Such increased Wnt-11 expression likely contributed to the XKaiso depletion phenotype because a dominant negative form of Wnt-11 or of the downstream effector Dishevelled partially rescued the observed gastrulation defects. These results show that XKaiso is essential for proper gastrulation movements, resulting at least in part from its modulation of non-canonical Wnt signaling. The significance of the XKaiso-p120 catenin interaction has yet to be determined, but appears to include a role in modulating genes promoting canonical and non-canonical Wnt signals. ^
Resumo:
The FsrABC system of Enterococcus faecalis controls the expression of gelatinase and a serine protease via a quorum-sensing mechanism, and recent studies suggest that the Fsr system may also regulate other genes important for virulence. To investigate the possibility that Fsr influences the expression of additional genes, we used transcriptional profiling, with microarrays based on the E. faecalis strain V583 sequence, to compare the E. faecalis strain OG1RF with its isogenic mutant, TX5266, an fsrB deletion mutant. We found that the presence of an intact fsrB influences expression of numerous genes throughout the growth phases tested, namely, late log to early stationary phase. In addition, the Fsr regulon is independent of the activity of the proteases, GelE and SprE, whose expression was confirmed to be activated at all three time points tested. While expression of some genes (i.e., ef1097 and ef0750 to -757, encoding hypothetical proteins) was activated in late log phase in OG1RF versus the fsrB deletion mutant, expression of ef1617 to -1634 (eut-pdu orthologues) was highly repressed by the presence of an intact Fsr at entry into stationary phase. This is the first time that Fsr has been characterized as a negative regulator. The newly recognized Fsr-regulated targets include other factors, besides gelatinase, described as important for biofilms (BopD), and genes predicted to encode the surface proteins EF0750 to -0757 and EF1097, along with proteins implicated in several metabolic pathways, indicating that the FsrABC system may be an important regulator in strain OG1RF, with both positive and negative effects.
Resumo:
Viral invasion of the central nervous system (CNS) and development of neurological symptoms is a characteristic of many retroviruses. The mechanism by which retrovirus infection causes neurological dysfunction has yet to be fully elucidated. Given the complexity of the retrovirus-mediated neuropathogenesis, studies using small animal models are extremely valuable. Our laboratory has used a mutant moloney murine leukemia retrovirus, ts1-mediated neurodegneration. We hypothesize that astrocytes play an important role in ts1-induced neurodegeneration since they are retroviral reservoirs and supporting cells for neurons. It has been shown that ts1 is able to infect astrocytes in vivo and in vitro. Astrocytes, the dominant cell population in the CNS, extend their end feet to endothelial cells and neuronal synapse to provide neuronal support. Signs of oxidative stress in the ts1-infected CNS have been well-documented from previous studies. After viral infection, retroviral DNA is generated from its RNA genome and integrated into the host genome. In this study, we identified the life cycle of ts1 in the infected astrocytes. During the infection, we observed reactive oxygen species (ROS) upregulations: one at low levels during the early infection phase and another at high levels during the late infection phase. Initially we hypothesized that p53 might play an important role in ts1-mediated astrocytic cell death. Subsequently, we found that p53 is unlikely to be involved in the ts1-mediated astrocytic cell death. Instead, p53 phosphorylation was increased by the early ROS upregulation via ATM, the protein encoded by the ataxia-telangiectasia (A-T) mutated gene. The early upregulation of p53 delayed viral gene expression by suppressing expression of the catalytic subunit of NADPH oxidase (NOX). We further demonstrated that the ROS upregulation induced by NOX activation plays an important role in establishing retroviral genome into the host. Inhibition of NOX decreased viral replication and delayed the onset of pathological symptoms in ts1-infected mice. These observations lead us to conclude that suppression of NOX not only prevents the establishment of the retrovirus but also decreases oxidative stress in the CNS. This study provides us with new perspectives on the retrovirus-host cell interaction and sheds light on retrovirus-induced neurodegeneration as a result of the astrocyte-neuron interaction.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^