Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Inhibitor of cytochrome c messenger RNA -protein interaction in stimulated rat skeletal muscle

The purpose of this work was to examine the possible mechanisms for the regulation of cytochrome c gene expression in response to increased contractile activity in rat skeletal muscle. The working hypothesis was that increased contractile activity enhances cytochrome c gene expression through a cis-element. A 110% increase in cytochrome c mRNA concentration was observed in tibialis anterior (TA) muscle after 9 days of chronic stimulation. Similar difference (120%) exists between soleus (SO) muscle of higher contractile activity and white vastus lateralis (WV) muscle of lower contractile activity. These results suggest that the endogenous cytochrome c gene expression is regulated by contractile activity. Cytochrome c-reporter genes were injected into skeletal muscles to identify the cis-element that is responsible for the regulation. Although the data was inconclusive, part of it suggested the importance of the 3$\sp\prime$-untranslated region (3$\sp\prime$-UTR) in mediating the response to increased contractile activity.^ RNA gel mobility shift (GMSA) and ultraviolet (UV) cross-linking assays revealed specific RNA-protein interaction in a 50-nucleotide region of the 3$\sp\prime$-UTR in unstimulated TA muscle. Computer analysis predicted a stem-loop structure of 17 nucleotides, which provides a structural basis for RNA-protein interaction. These 17 nucleotides are 100% conserved among rat, mouse and human cytochrome c genes and their 13 pseudogenes, suggesting a functional role for this region. The RNA-protein interaction was significantly less in highly active SO muscle than in inactive WV muscle and was dramatically decreased in stimulated TA muscle due to a protein inhibitor(s) associated with ribosome. It is possible that cytochrome c mRNAs undergoing translation are subject to a compartmentalized regulatory influence.^ The conclusion from these results is that increases in contractile activity induce or activate a protein inhibitor(s) associated with ribosome in rat skeletal muscle. The inhibitor decreases RNA-protein interaction in the 3$\sp\prime$-UTR of cytochrome c mRNA, which may result in increased mRNA stability and/or translation. ^