40 resultados para Apoptosis Regulatory Proteins
Resumo:
Gastrointestinal stromal tumors (GISTs) are oncogene-addicted cancers driven by activating mutations in the genes encoding receptor tyrosine kinases KIT and PDGFR-α. Imatinib mesylate, a specific inhibitor of KIT and PDGFR-α signaling, delays progression of GIST, but is incapable of achieving cure. Thus, most patients who initially respond to imatinib therapy eventually experience tumor progression, and have limited therapeutic options thereafter. To address imatinib-resistance and tumor progression, these studies sought to understand the molecular mechanisms that regulate apoptosis in GIST, and evaluate combination therapies that kill GISTs cells via complementary, but independent, mechanisms. BIM (Bcl-2 interacting mediator of apoptosis), a pro-apoptotic member of the Bcl-2 family, effects apoptosis in oncogene-addicted malignancies treated with targeted therapies, and was recently shown to mediate imatinib-induced apoptosis in GIST. This dissertation examined the molecular mechanism of BIM upregulation and its cytotoxic effect in GIST cells harboring clinically-representative KIT mutations. Additionally, imatinib-induced alterations in BIM and pro-survival Bcl-2 proteins were studied in specimens from patients with GIST, and correlated to apoptosis, FDG-PET response, and survival. Further, the intrinsic pathway of apoptosis was targeted therapeutically in GIST cells with the Bcl-2 inhibitor ABT-737. These studies show that BIM is upregulated in GIST cells and patient tumors after imatinib exposure, and correlates with induction of apoptosis, response by FDG-PET, and disease-free survival. These studies contribute to the mechanistic understanding of imatinib-induced apoptosis in clinically-relevant models of GIST, and may facilitate prediction of resistance and disease progression in patients. Further, combining inhibition of KIT and Bcl-2 induces apoptosis synergistically and overcomes imatinib-resistance in GIST cells. Given that imatinib-resistance and GIST progression may reflect inadequate BIM-mediated inhibition of pro-survival Bcl-2 proteins, the preclinical evidence presented here suggests that direct engagement of apoptosis may be an effective approach to enhance the cytotoxicity of imatinib and overcome resistance.
Resumo:
Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Follicular lymphoma is the most common lymphoid malignancy in humans. The bcl-2 transgenic mice, which mimic the human follicular lymphoma, initially exhibit a polyclonal hyperplasia due to the overriding of apoptosis by deregulated bcl-2. After a latency period of 15 month 20% of the animals developed clonal lymphomas. Approximately, 50% of these high grade lymphomas presented chromosomal translocations involving c-myc, suggesting that deregulation of this gene is important in the complementation with bcl-2. E$\mu$-myc x bcl-2 double transgenic mice were generated to assess the ability of this two genes to complement in an in vivo system. The double transgenic mice presented a shortened latency (3-4 weeks) and higher incidence of tumor development. Quantification of the extent of programmed cell death indicated that bcl-2 can abrogate the high rate of apoptotic cell death that results from myc deregulation. Bcl-2-Ig, E$\mu$-myc, and bcl-2/E$\mu$-myc lymphomas were examined using PCR-SSCP to detect the presence of p53 mutations in exons 5-9. A high incidence of p53 mutations in E$\mu$-myc lymphomas suggested that inactivating lesions of p53 may represent an important step in the genetic complementation of c-myc in lymphomagenesis. Surprisingly, p53 mutations were quite uncommon in bcl-2 lymphomas suggesting that inactivating mutations of p53 and overexpression of bcl-2 may not cooperate in lymphoma progression. To assess this question, we generated mice that contained a deregulated bcl-2 gene and were nullizygous for p53 (p53KO). No reduction in the tumor latency was observed in the p53KO/bcl-2-Ig hybrid mice when compared with p53 KO mice. Using splenic mononuclear cells isolated from p53KO mice and bcl-2 transgenic mice we demonstrated that bcl-2 suppresses p53 mediated apoptosis in response to DNA damage initiated by $\gamma$-radiation even though p53 protein is induced normally in the bcl-2 overexpressing cells. Western analysis of the expression of p53 target proteins after $\gamma$-radiation showed a correlation between the p53-dependent induction of bax protein after radiation and the ability of p53 to mediate apoptosis. ^
Resumo:
Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^
Resumo:
The p53 gene is known to be one of the most commonly mutated genes in human cancers. Many squamous cell carcinomas of the head and neck (SCCHNs) have been shown to contain nonfunctional p53 as well. The use of p53-mediated gene therapy to treat such cancers has become an intensive area of research. Although there have been varied treatment responses to p53 gene therapy, the role that endogenous p53 status plays in this response has not been thoroughly examined. Because of this, the hypothesis of this study examined the role that the endogenous p53 status of cells plays in their response to p53 gene therapy. To test this, an adenoviral vector containing p53 (p53FAd) was administered to three squamous cell carcinoma lines with varied endogenous p53. The SCC9 cell line demonstrates no p53 protein expression, the SCC4 cell line displays overexpression of a mutant p53 protein, and the 1986LN cell line displays low to no expression of wild-type p53 protein as a consequence of human papillomavirus infection. After treatment with p53FAd, the cells were examined for evidence of exogenous p53 expression, growth suppression, alterations in cellular proteins, G1 growth arrest, apoptosis, and differentiation state. Each cell line exhibited exogenous p53 protein. Growth suppression was seen most prominently in the SCC9 cells, to some extent in the 1986LN cells, and little was seen with the SCC4 cells. WAF1/p21 protein was induced in all three cell lines, while PCNA, bcl-2, and bax expression was not significantly affected in any of the lines. Apoptosis developed first in SCC9 cells, next in 1986LN cells, with little seen in the SCC4 cells. The SCC9 line was the only line to show significant GI growth arrest. No significant differences were observed in the overall expression of differentiation markers, aside from increased keratin 13 mRNA levels in all three lines indicating a possible tendency toward differentiation. This study indicates that the endogenous p53 status of squamous cell carcinomas appears to play a critical role in determining the response to p53 adenoviral gene therapy. ^
Resumo:
The p53 tumor suppressor gene product is negatively regulated by the product of its downstream target, mdm2. The mdm2 oncogene abrogates p53 transactivation function. Amplification of mdm2 occurs in 36% of human sarcomas, which often retain p53 in wild type form, suggesting that overexpression of mdm2 in tumors results in p53 inactivation. Thus, the relationship of p53 to mdm2 is important in tumorigenesis. The deletion of mdm2 in the mouse results in embryonic lethality by 5.5 days post coitum. Embryonic lethality of the mdm2 null embryos was overcome by simultaneous loss of the p53 tumor suppressor, which substantiates the importance of the negative regulatory function of MDM2 on p53 function in vivo. These data suggest that the loss of MDM2 function allowed the constitutively active p53 protein to induce either a complete G1 arrest or the p53-dependent apoptotic pathway, resulting in the death of the mdm2−/− embryos.^ The present study examines the hypothesis that the absence of mdm2 induces apoptosis due to p53 activation. Viability of the p53−/−mdm2−/− mice has allowed establishment of mouse embryo fibroblasts (MEFs) and a detailed examination of the properties of these cells. To introduce p53 into this system, and essentially recreate a mdm2 null cell, a temperature sensitive p53 (tsp53) point mutant (A135V) was used, which exhibits a nonfunctional, mutant conformation at 39°C and wild type, functional conformation at 32°C. Infected pools of p53−/− and p53−/−mdm2−/− MEFs with the tsp53 gene were established and single-cell clonal populations expressing tsp53 were selected. Shifting the cells from 39°C to 32°C caused p53−/−mdm2 −/− lines expressing tsp53 to undergo up to 80% apoptosis, which did not occur in the p53−/− lines expressing tsp53 nor the parental lines lacking p53 expression. Furthermore, the amount of p53 present in the clonal population determined the extent of apoptosis. Tsp53 is transcriptionally active in this system, however, it discriminates among different target promoters and does not induce the apoptosis effector targets bax or Fas/Apo1. ^ In summary, this study indicates that the presence or absence of mdm2 is the determining factor for the ability of p53 to trigger apoptosis in this system. The loss of mdm2 promotes p53-dependent apoptosis in MEFs in a cell cycle and dose-dependent manner. p53 is differentially phosphorylated in the presence and absence of mdm2, but does not induce the apoptosis effectors, bax or Fas/ Apo1. ^
Resumo:
Elevated expression levels of the bcl-2 proto-oncogene have been correlated with the appearance of androgen independence in prostate cancer. Although bcl-2 was first cloned as the t (14:18) translocation breakpoint from human follicular B cell lymphoma, the mechanism of overexpression of bcl-2 is largely undefined for advanced prostate cancer, there being no gross alterations in the gene structure. We investigated the role of the product of the prostate apoptosis response gene-4 (Par-4) and the product of the Wilms' tumor 1 gene (WT1) in the regulation of Bcl-2 expression in prostate cancer cell lines. We observed growth arrest and apoptosis, upon decreasing Bcl-2 protein and transcript in the high Bcl-2 expressing, androgen-independent prostate cancer cell lines, by all trans-retinoic acid treatment but this did not occur in the androgen-dependent cell lines expressing low levels of Bcl-2. Changes in localization of Par-4, and an induction in the expression of WT1 protein accompanied the decrease in the Bcl-2 protein and transcript following all trans-retinoic acid treatment, in the androgen-independent prostate cancer cell line. In stable clones expressing ectopic Par-4 we observed decreased Bcl-2 protein and transcript. This was accompanied by an induction in WT1 expression. Finally, we detected Par-4 and WT1 proteins binding to a previously identified WT1 binding site on the bcl-2 promoter both in vitro and in vivo leading to a decrease in transcription from the bcl-2 promoter. We conclude that Par-4 regulates Bcl-2 through a WT1 binding site on the bcl-2 promoter. ^
Resumo:
Ras proteins (H-, N-, K4A-, and K4B) are associated with cellular resistance to ionizing radiation (IR) and, consequently, may provide a potential target for radiosensitization strategies in cancer treatment. Several approaches have been used to compromise Ras activity and enhance IR-induced cell killing; however, these techniques either target proteins in addition to Ras or only target one member of the Ras family. In this study, I have used an adenovirus (AV1Y28) that expresses a single-chain antibody fragment directed against Ras proteins to investigate the mechanism(s) responsible for Ras-mediated radiation resistance. AV1Y28 enhanced the radiosensitivity of a number of human tumor cell lines without affecting the radiosensitivity of normal human fibroblasts. Whereas AV1Y28-mediated sensitization was independent of ras gene mutational status, it was dependent on active Ras proteins suggesting that AV1Y28 may be useful against a broad range of tumors. AV1Y28-mediated cell killing was not the result of redistributing cells into a more radiosensitive phase of the cell cycle and did not enhance IR-induced apoptosis. Given that Ras proteins transduce environmental signals to the nucleus, the effect of AV1Y28 on the IR-inducible transcription factor NF-κB were determined. Although AV1Y28 inhibited IR-induced NF-κB through the suppression of IKK, additional work established that NF-κB did not play a role in AV1Y28-mediated radiosensitization. However, a novel component of the signaling pathway responsible for IR-induced NF-κB was identified. Previous studies had suggested a relationship between mutant ras genes and IR-induced G2 delay; therefore the effects of AV1Y28 on the progression of cells from G2 to M after IR were determined. Pretreatment of cells with AV1Y28 prevented the IR-induced G2 arrest. AV1Y28-mediated abrogation of IR-induced G2 arrest correlated with those cell line lines that were sensitized by AV1Y28. Moreover, a significant increase in cells undergoing mitotic catastrophe was found after IR in AV1Y28 treated cells. The abrogation of G2 arrest by AV1Y28 was the result of maintaining the active form of cdc2, an inducer of mitosis, after exposure to IR. This study identified the mechanism of AV1Y28-mediated radiosensitization and has provided insight into the signal transduction pathways responsible for Ras-mediated radiation resistance. ^
Resumo:
The aberrant activation of signal transduction pathways has long been linked to uncontrolled cell proliferation and the development of cancer. The activity of one such signaling module, the Mitogen-Activated Protein Kinase (MAPK) pathway, has been implicated in several cancer types including pancreatic, breast, colon, and lymphoid malignancies. Interestingly, the activation of MAP-Kinase-Kinase-Kinase proteins often leads to the additional activation of NF-κB, a transcription factor that acts as a cell survival signal through its control of antiapoptotic genes. We have investigated the role of a specific dimer form of the NF-κB transcription factor family, NF-κB1 (p50) homodimers, in its control of the proto-oncogene, Bcl-2, and we have identified the MEK/ERK (MAPK) signaling cascade as a mediator of NF-κB1 activity. ^ Two murine B cell lymphoma cell lines were used for these studies: LY-as, an apoptosis proficient line with low Bcl-2 protein expression and no nuclear NF-κB activity, and LY-ar, a nonapoptotic line with constitutive p50 homodimer activity and 30 times more Bcl-2 protein expression than LY-as. Experiments modulating p50 activity correlated the activation of p50 homodimers with Bcl-2 expression and additional gel shift experiments demonstrated that the Bcl-2 P1 promoter had NF-κB sites with which recombinant p50 was able to interact. In vitro transcription revealed that p50 enhanced the production of transcripts derived from the Bcl-2 P1 promoter. These data strongly suggest that Bcl-2 is a target gene for p50-mediated transcription and suggest that the activation of p50 homodimers contributes to the expression of Bcl-2 observed in LY-ar cells. ^ Studies of upstream MAPK pathways that could influence NF-κB activity demonstrated that LY-ar cells had phosphorylated ERK proteins while LY-as cells did not. Treatment of LY-ar cells with the MEK inhibitors PD 98059, U0126, and PD 184352 led to a loss of phosphorylated ERK, a reversal of nuclear p50 homodimer DNA binding, and a decrease in the amount of Bcl-2 protein expression. Similarly, the activation of the MEK/ERK pathway in LY-as cells by phorbol ester led to Bcl-2 expression that could be blocked by PD 98059. Furthermore, treatment of LY-ar cells with TNFα, an IKK activator, did not change the suppressive effect of PD 98059 on p50 homodimer activity, suggesting an IKK-independent pathway for p50 homodimer activation. Lastly, all three MEK inhibitors sensitized LY-ar cells to radiation-induced apoptosis. ^ These data indicate that the activation of the MEK/ERK MAP-Kinase signaling pathway acts upstream of p50 homodimer activation and Bcl-2 expression in this B cell lymphoma cell system and suggest that the activation of MEK/ERK may be a key step in the progression of lymphoma to advanced-staged disease. Other researchers have used MEK inhibitors to inhibit cell growth and sensitize a number of tumors to chemotherapies. In light of our data, MEK inhibitors may additionally be useful clinically to radiosensitize cancers of lymphoid origin. ^