Dynamics of a minimal model of interlocked positive and negative feedback loops of transcriptional regulation by cAMP-response element binding proteins.

cAMP-response element binding (CREB) proteins are involved in transcriptional regulation in a number of cellular processes (e.g., neural plasticity and circadian rhythms). The CREB family contains activators and repressors that may interact through positive and negative feedback loops. These loops can be generated by auto- and cross-regulation of expression of CREB proteins, via CRE elements in or near their genes. Experiments suggest that such feedback loops may operate in several systems (e.g., Aplysia and rat). To understand the functional implications of such feedback loops, which are interlocked via cross-regulation of transcription, a minimal model with a positive and negative loop was developed and investigated using bifurcation analysis. Bifurcation analysis revealed diverse nonlinear dynamics (e.g., bistability and oscillations). The stability of steady states or oscillations could be changed by time delays in the synthesis of the activator (CREB1) or the repressor (CREB2). Investigation of stochastic fluctuations due to small numbers of molecules of CREB1 and CREB2 revealed a bimodal distribution of CREB molecules in the bistability region. The robustness of the stable HIGH and LOW states of CREB expression to stochastic noise differs, and a critical number of molecules was required to sustain the HIGH state for days or longer. Increasing positive feedback or decreasing negative feedback also increased the lifetime of the HIGH state, and persistence of this state may correlate with long-term memory formation. A critical number of molecules was also required to sustain robust oscillations of CREB expression. If a steady state was near a deterministic Hopf bifurcation point, stochastic resonance could induce oscillations. This comparative analysis of deterministic and stochastic dynamics not only provides insights into the possible dynamics of CREB regulatory motifs, but also demonstrates a framework for understanding other regulatory processes with similar network architecture.

Saturday Morning Television Advertisements Aired on English and Spanish Language Networks along the Texas-Mexico Border

Objectives: The aim of this content analysis study is to characterize the TV advertisements aired to an at-risk child population along the Texas-Mexico border. Methods: We characterized the early Saturday morning TV advertisements aired by three broadcast network categories (U.S. English language, U.S. Spanish language, and Mexican Spanish language) in Spring 2010. The number, type (food related vs. non-food related), target audience, and persuasion tactics used were recorded. Advertised foods, based on nutrition content, were categorized as meeting or not meeting current dietary guidelines. Results: Most commercials were non-food related (82.7%, 397 of 480). The majority of the prepared foods (e.g., cereals, snacks, and drinks) advertised did not meet the current U.S. Dietary Guidelines. Additionally, nutrition content information was not available for many of the foods advertised on the Mexican Spanish language broadcast network category. Conclusions: For U.S. children at risk for obesity along the Texas-Mexico border exposure to TV food advertisements may result in the continuation of sedentary behavior as well as an increased consumption of foods of poor nutritional quality. An international regulatory effort to monitor and enforce the reduction of child-oriented food advertising is needed. Editors' Note: This article was submitted in response to the first issue of the Journal of Applied Research on Children: Latino Children.

Transcriptional regulation of the invariant chain associated with MHC class II molecules

The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^

Transcriptional regulation of the chicken MLC3f gene

The expression of the chicken fast skeletal myosin alkali light chain (MLC) 3f is subject to complex patterns of control by developmental and physiologic signals. Regulation over MLC3f gene expression is thought to be exerted primarily at the transcriptional level. The purpose of this dissertation was to identify cis-acting elements on the 5$\sp\prime$ flanking region of chicken MLC3f gene that are important for transcriptional regulation. The results show that the 5$\sp\prime$ flanking region of MLC3f gene contains multiple cis-acting elements. The nucleotide sequence of these elements demonstrates a high degree of conservation between different species and are also found in the 5$\sp\prime$ flanking regions of many muscle protein genes. The first regulatory region is located between $-$185 and $-$150 bp from the transcription start site and contains an AT-rich element. Linker scanner analyses have revealed that this element has a positive effect on transcription of the MLC3f promoter. Furthermore, when linked to a heterologous viral promoter, it can enhance reporter gene expression in a muscle-specific manner, independent of distance or orientation.^ The second regulatory region is located between $-$96 and $-$64 from the transcription start site. Sequences downstream of $-$96 have the capacity to drive muscle-specific reporter gene expression, although the region between $-$96 and $-$64 has no intrinsic enhancer-like activity. Linker scanner analyses have identified a GC-rich motif that required efficient transcription of the MLC3f promoter. Mutations to this region of DNA results in diminished capacity to drive reporter gene expression and is correlated with disruption of the ability to bind sequence-specific transcription factors. These sequence-specific DNA-binding proteins were detected in both muscle and non-muscle extracts. The results suggest that the mere presence or absence of transcription factors cannot be solely responsible for regulation of MLC3f expression and that tissue-specific expression may arise from complex interactions with muscle-specific, as well as more ubiquitous transcription factors with multiple regulatory elements on the gene. ^

Transcriptional regulation and functional analysis of the human Wilms' tumor 1 gene

The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^

Regulatory factors and control of anthrax toxin gene expression

Bacillus anthracis plasmid pXO1 carries genes for three anthrax toxin proteins, pag (protective antigen), cya (edema factor), and lef (lethal factor). Expression of the toxin genes is enhanced by two signals: CO$\sb2$/bicarbonate and temperature. The CO$\sb2$/bicarbonate effect requires the presence of pXO1. I hypothesized that pXO1 harbors a trans-acting regulatory gene(s) required for CO$\sb2$/bicarbonate-enhanced expression of the toxin genes. Characterization of such a gene(s) will lead to increased understanding of the mechanisms by which B. anthracis senses and responds to host environments.^ A regulatory gene (atxA) on pXO1 was identified. Transcription of all three toxin genes is decreased in an atxA-null mutant. There are two transcriptional start sites for pag. Transcription from the major site, P1, is enhanced in elevated CO$\sb2$. Only P1 transcripts are significantly decreased in the atxA mutant. Deletion analysis of the pag upstream region indicates that the 111-bp region upstream of the P1 site is sufficient for atxA-mediated increase of this transcript. The cya and lef genes each have one apparent transcriptional start site. The cya and lef transcripts are significantly decreased in the atxA mutant. The atxA mutant is avirulent in mice. The antibody response to all three toxin proteins is significantly decreased in atxA mutant-infected mice. These data suggest that the atxA gene product activates expression of the toxin genes and is essential for virulence.^ Since expression of the toxin genes is dependent on atxA, whether increased toxin gene expression in response to CO$\sb2$/bicarbonate and temperature is associated with increased atxA expression was investigated. I monitored steady state levels of atxA mRNA and AtxA protein in different growth conditions. The results indicate that expression of atxA is not influenced by CO$\sb2$/bicarbonate. Steady state levels of atxA mRNA and AtxA protein are higher at 37$\sp\circ$C than 28$\sp\circ$C. However, increased pag expression at high temperature can not be attributed directly to increased atxA expression.^ There is evidence that an additional factor(s) may be involved in regulation of pag. Expression of pag in strains overproducing AtxA is significantly decreased compared to the wildtype strain. A specific interaction of tagged-AtxA with the pag upstream DNA has not been demonstrated. Furthermore, four proteins in B. anthracis extract can be co-immunoprecipitated with tagged-AtxA. Amino-terminal sequence of one protein has been determined and found highly homologous to chaperonins of GroEL family. Studies are under way to determine if this GroEL-like protein interactions with AtxA and plays any role in atxA-mediated activation of toxin genes. ^

Transcriptional regulation of the human {\it PAX6\/} gene

PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^

Transcriptional upregulation of the p21Cip1 promoter by STAT3 and nuclear ErbB2

Over-expression of the receptor tyrosine kinase ErbB2 is prevalent in approximately 30% of human breast carcinomas and confers Taxol resistance. In breast cancer cells, Taxol induces tubulin polymerization and hyperstable microtubule formation. This in turn prematurely activates Cdc2 kinase allowing early entry into the G2/M phase of the cell cycle resultant in mitotic catastrophe followed by apoptosis. Over-expression of ErbB2 upregulates p21Cip1, which inhibits Cdc2 activation, and leads to Taxol resistance in patients. However, the mechanism of ErbB2-mediated p21 Cip1 upregulation is unclear. Here in this study, we investigated the mechanism of ErbB2 downstream signaling events leading to upregulation. The CDKN1A (p21Cip1) gene promoter contains numerous cis-elements including a Signal transducer and activator of transcription (STAT) Inducable Element (SIE) located at -679 kb. Our studies showed ErbB2 overexpressing cells had increased activated levels of STAT3, and therefore we hypothesized that STAT3 is responsible for the upregulation of the p21Cip1 promoter by ErbB2. EMSA and ChIP assays confirmed the binding of STAT3 to the p21Cip1 promoter and luciferase assays showed higher p21 Cip1 promoter activity in ErbB2 over-expressing transfectants when compared to parental cells, in a STAT3 binding site dependant manner. Additionally, reduced level of STAT3 led to reduced p21Cip1 protein expression and promoter activity indicating that both the STAT3 binding site and STAT3 protein are required for ErbB2-mediated p21Cip1 upregulation. Further investigation of ErbB2 downstream signaling showed increased Src kinase activity in ErbB2 over-expressing cells which was required for ErbB2-mediated STAT3 activation and p21Cip1 increase. Treatment of ErbB2 over-expressing resistant cells with STAT3 inhibitor peptides sensitized the cells to Taxol. In addition to classical signal transduction pathways, I identified a novel ErbB2 mediated regulatory mechanism of p21Cip1. I found that a nuclear ErbB2 and STAT3 complex binds directly to the p21Cip1 promoter offering a non-classical mechanism of p21Cip1 promoter regulation. These data suggest that ErbB2 over-expression can confer Taxol resistance of breast cancer cells by transcriptional upregulation of p21 Cip1 via activation of STAT3 by Src kinase and also by cooperation with nuclear ErbB2. The data suggest a potential clinical mechanism for STAT3 inhibitors in sensitizing ErbB2 over-expressing breast cancers to Taxol. ^

Transcriptional and translational regulators of gene expression in germ cell development

Germ cell development is a highly coordinated process driven, in part, by regulatory mechanisms that control gene expression. Not only transcription, but also translation, is under regulatory control to direct proper germ cell development. In this dissertation, I have focused on two regulators of germ cell development. One is the homeobox protein RHOX10, which has the potential to be both a transcriptional and translational regulator in mouse male germ cell development. The other is the RNA-binding protein, Hermes, which functions as a translational regulator in Xenopus laevis female germ cell development. ^ Rhox10 is a member of reproductive homeobox gene X-(linked (Rhox) gene cluster, of which expression is developmentally regulated in developing mouse testes. To identify the cell types and developmental stages in which Rhox10 might function, I characterized its temporal and spatial expression pattern in mouse embryonic, neonatal, and adult tissues. Among other things, this analysis revealed that both the level and the subcellular localization of RHOX10 are regulated during germ cell development. To understand the role of Rhox10 in germ cell development, I generated transgenic mice expressing an artificial microRNA (miRNA) targeting Rhox10. While this artificial miRNA robustly downregulated RHOX10 protein expression in vitro, it did not significantly reduce RHOX10 expression in vivo. So I next elected to knockdown RHOX10 levels in spermatogonial stem cells (SSCs), which I found highly express both Rhox10 mRNA and RHOX10 protein. Using a recently developed in vitro culture system for SSCs combined with a short-hairpin RNA (shRNA) approach, I strongly depleted RHOX10 expression in SSCs. These RHOX10-depleted cells exhibited a defect in the ability to form stem cell clusters in vitro. Expression profiling analysis revealed many genes regulated by Rhox10, including many meiotic genes, which could be downstream of Rhox10 in a molecular pathway that controls SSC differentiation. ^ RNA recognition motif (RRM) containing protein, Hermes is localized in germ plasm, where dormant mRNAs are also located, of Xenopus oocytes, which implicates its role in translational regulator. To understand the function of Hermes in oocyte meiosis, I used a morpholino oligonucleotide (MO) based knockdown approach. Microinjection of Hermes MO into fully grown oocytes, which are arrested in meiotic prophase, caused acceleration of oocytes reentry into meiosis (i.e., maturation) upon progesterone induction. Using a candidate approach, I identified at least three targets of Hermes: Ringo/Spy, Xcat2, and Mos. Ringo/Spy and Mos are known to have functions in oocyte maturation, while Ringo/Spy, Xcat2 mRNA are localized in the germ plasm of oocytes, which drives germ cell specification after fertilization. This led me to propose that Hermes functions in both oocyte maturation and germ cell development through its ability to regulate 3 crucial target mRNAs. ^

From protein microarray to biology: The discovery of epigenetic regulatory molecules

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

TRANSCRIPTIONAL AND POST-TRANSLATIONAL MECHANISMS CONTRIBUTE TO MAINTENANCE OF REST IN NEURAL TUMORS

The RE-1 silencing transcription factor (REST) is an important regulator of normal nervous system development. It negatively regulates neuronal lineage specification in neural progenitors by binding to its consensus RE-1 element(s) located in the regulatory region of its target neuronal differentiation genes. The developmentally coordinated down-regulation of REST mRNA and protein in neural progenitors triggers terminal neurogenesis. REST is overexpressed in pediatric neural tumors such as medulloblastoma and neuroblastoma and is associated with poor neuronal differentiation. High REST protein correlate with poor prognosis for patients with medulloblastoma, however similar studies have not been done with neuroblastoma patients. Mechanism(s) underlying elevated REST levels medulloblastoma and neuroblastoma are unclear, and is the focus of this thesis project. We discovered that transcriptional and post-translational mechanisms govern REST mis-regulation in medulloblastoma and neuroblastoma. In medulloblastoma, REST transcript is aberrantly elevated in a subset of patient samples. Using loss of function and gain of function experiments, we provide evidence that the Hairy Enhancer of Split (HES1) protein represses REST transcription in medulloblastoma cell lines, modulates the expression of neuronal differentiation genes, and alters the survival potential of these cells in vitro. We also show that REST directly represses its own expression in an auto-regulatory feedback loop. Interestingly, our studies identified a novel interaction between REST and HES1. We also observed their co-occupancy at the RE-1 sites, thereby suggesting potential for co-regulation of REST expression. Our pharmacological studies in neuroblastoma using retinoic acid revealed that REST levels are controlled by transcriptional and post-transcriptional mechanisms. Post-transcriptional mechanisms are mediated by modulation of E3 ligase or REST, SCFβ-TRCP, and contribute to resistance of some cells to retinoic acid treatment.

Transcriptional regulation of the {\it neu\/} oncogene and its negative regulation by the c-{\it myc\/} oncogene

The first part of my research involved the characterization of the neu gene promoter. I subcloned a 2.2-kb sequence located upstream to the extreme 5$\sp\prime$ end of the neu gene, in front of the bacterial reporter gene, chloramphenicol acetyltransferase (CAT). Transfection of this construct into different cell lines and subsequent CAT assays demonstrated that this 2.2-kb fragment was functional as a promoter. A series of deletion constructs was engineered to study the contribution of different fragments to transcription. Subcloning of individual fragments was followed by a cotransfection competition experiment, which demonstrated the involvement of protein factors interacting with the promoter. A gel retardation assay was also performed to show the physical binding of protein factors to the promoter. The combined results suggested that both positively and negatively acting protein factors are involved in interacting with different regions of the promoter, contributing to the overall transcription activity. My findings provide an insight into the regulation of neu gene expression, which in turn provides the tools to understand the molecular mechanisms of overexpression of the neu gene in some breast cancer and ovarian cancer cell lines.^ In the second part of my research, I discovered that another oncogene, c-myc, was able to reverse the transformed morphology that was induced by the neu oncogene. Utilizing the promoter constructs that I made, I was able to show that the c-myc oncogene has a negative regulatory effect on the expression of the neu oncogene. Further studies suggested that c-myc is able to lower the effective concentration of a positive factor(s) that interact with a 139-bp fragment of the neu gene promoter. These findings may provide a direct evidence of the long suspected role of the c-myc gene in transcriptional regulation. The neu gene may very well be the first identified mammalian target gene that is regulated by the c-myc oncogene. Since c-myc is known to be stimulated by various mitogenic signals and the neu gene is likely to be a growth factor receptor, it is possible that c-myc, when stimulated by the signal transduction pathway of the neu gene, would function as a negative feedback regulator on the neu gene receptor. (Abstract shortened with permission of author.) ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Transcriptional repression of serum amyloid A1 by AP -2 contributes to its liver -specific expression

Studies on the transcriptional regulation of serum amyloid A1 (SAA1) gene, a liver specific acute-phase gene, identified a regulatory element in its promoter that functioned to repress (SAA1) gene transcription in nonliver cells. This silencer element interacts with a nuclear protein that is detectable in HeLa cells, fibroblasts and placental tissues but not in liver or liver-derived cells. As the expression pattern of this repressor is consistent with its potential regulatory role in repressing SAA1 expression, and that many other liver gene promoters also contain this repressor binding site, we sought to investigate whether this repressor may have a broader functional role in repressing liver genes. ^ We have utilized protein purification, cell culture, transient and stable gene transfection, and molecular biology approaches to identify this protein and investigate its possible function in the regulation of (SAA1) and other liver genes. Analyses of amino acid sequence of the purified nuclear protein, and western blot and gel shift studies identified the repressor as transcription factor AP-2 or AP-2-like protein. Using transient transfection of DNA into cultured cells, we demonstrate that AP-2 can indeed function as a repressor to inhibit transcription of SAA1 gene promoter. This conclusion is supported by the following experimental results: (1) overexpression of AP-2 in hepatoma cells inhibits conditioned medium (CM)-induced expression of SAA1 promoter; (2) binding of AP-2 to the SAA1 promoter is required for AP-2 repression function; (3) one mechanism by which AP-2 inhibits SAA1 may be by antagonizing the activation function of the strong transactivator NFκB; (4) mutation of AP-2 binding sites results in derepression of SAM promoter in HeLa cells; and (5) inhibition of endogenous AP-2 activity by a dominant-negative mutant abolishes AP-2's inhibitory effect on SAM promoter in HeLa cells. In addition to the SAM promoter, AP-2 also can bind to the promoter regions of six other liver genes tested, suggesting that it may have a broad functional role in restricting the expression of many liver genes in nonliver cells. Consistent with this notion, ectopic expression of AP-2 also represses CM-mediated activation of human third component of complement 3 promoter. Finally, in AP-2-expressing stable hepatoma cell lines, AP-2 inhibits not only the expression of endogenous SAA, but also the expression of several other endogenous liver genes including albumin, α-fetoprotein. ^ Our findings that AP-2 has the ability to repress the expression of liver genes in nonliver cells opens a new avenue of investigation of negative regulation of gene transcription, and should improve our understanding of tissue-specific expression of liver genes. In summary, our data provide evidence suggesting a novel role of AP-2 as a repressor, inhibiting the expression of liver genes in nonliver cells. Thus, the tissue-specific expression of AP-2 may constitute an important mechanism contributing to the liver-specific expression of liver genes. ^