Functional characterization of transcription factor USF

USF, Upstream Stimulatory Factor, is a family of ubiquitous transcription factors that contain highly conserved basic helix-loop-helix leucine zipper DNA binding domains and recognize the core DNA sequence CACGTG. In human and mouse, two members of the USF family, USF1 and USF2, encoded by two different genes, contribute to the USF activity. In order to gain insights into the mechanisms by which USFs function as transcriptional activators, different approaches were used to map the domains of USF2 responsible for nuclear localization and transcriptional activation. Two stretches of amino acids, one in the basic region of the DNA binding domain, the other in a highly conserved N-terminal region, were found to direct nuclear localization independently of one another. Two distinct activation domains were also identified. The first one, located in the conserved N-terminal region that overlaps the C-terminal nuclear localization signal, functioned only in the presence of an initiator element in the promoter of the reporter. The second, in a nonconserved region, activated transcription in the absence of an initiator element or when fused to a heterologous DNA binding domain. These results suggest that USF2 functions in different promoter contexts by selectively utilizing different activation domains.^ The deletion analysis of USF2 also identified two dominant negative mutants of USF, one lacking the activation domain, the other lacking the basic domain. The latter proved useful for testing the direct involvement of USFs in the transcriptional activation mediated by the viral protein IE62.^ To investigate the biological function of USFs, foci and colony formation assays were used to study the growth regulation by USFs. It was found that USFs had a strong antagonistic effect on cellular transformation mediated by the bHLH/LZ protein Myc. This effect required the DNA binding activity of either USF 1 or USF2. Moreover, USF2, but not USF1 or other mutants of USFs, was also found to have strong inhibitory effect on the cellular transformation by E1a and on the growth of HeLa cells. These results demonstrate that USFs could potentially regulate growth through two mechanisms, one by antagonizing the function of Myc in cellular transformation, the other by mediating a more general growth inhibitory effect. ^

Cloning and characterization of the mouse ret finger protein (rfp), a B box zinc finger protein

An important question in biology is to understand the role of specific gene products in regulating embryogenesis and cellular differentiation. Many of the regulatory proteins possess specific motifs, such as the homeodomain, basic helix-loop-helix structure, zinc finger, and leucine zipper. These sequence motifs participate in specific protein-DNA, protein-RNA, and protein-protein interactions, and are important for the function of these regulatory proteins.^ The human rfp (ret finger protein) belongs to a novel zinc finger protein family, the B box zinc finger family. Most of the B box proteins, including rfp, have a conserved tripartite motif, consisting of two novel zinc fingers (the RING finger and the B box) and a coiled-coil domain. Interestingly, a fusion protein between the tripartite motif of rfp and the tyrosine kinase domain of c-ret has transforming activity. In this study, we examined the expression of rfp during mouse development, and characterized the role of the tripartite motif in rfp function.^ We cloned the mouse rfp cDNA, which shares a 98.4% homology with the human sequence at amino acid level. Such strikingly high degree of homology indicates the high evolutionary pressure on the conservation of the sequence, suggesting that rfp may have an important function. Using the somatic cell hybrid system, we assigned the rfp gene to mouse chromosome 13 and human chromosome 6. Rfp transcripts and protein were ubiquitous in day 10.5-13.5 mouse embryos; however, they were restricted in adult mice, with the highest level of expression in the testis. Rfp expression in the testis is detected only in late pachytene spermatocytes and round spermatids. In both embryos and spermatogenic cells, rfp protein was distributed within cell nuclei in a punctate pattern, similar to the PODs (PML oncogenic domains) observed with another B box protein, PML. In cultured mammalian cells, we found that rfp was indeed co-localized to the PODs with PML. Using the yeast two-hybrid system, we showed that the rfp could specifically interact with PML, and that the interaction was dependent on the distal portion of the rfp coiled-coil domain.^ We also showed that rfp could form homodimers, and both the B box and coiled-coil domain were required for proper dimerization. It seems that the proximal portion of the coiled-coil domain provides the interacting interface, while the B box zinc finger orients the coil and maintains the correct structure of the whole molecule. Our data are consistent with the zinc-binding property and structural analysis of the B box. The RING finger seems to be involved in rfp nuclear localization through interaction with other proteins. We believe that homodimerization and interaction with PML are important for the normal interaction of rfp during development and differentiation. In addition, rfp homodimerization may also be essential for the oncogenic activation of the rfp-ret fusion protein. ^

Identification of the signal pathways modulated by expression of p210$\rm\sp{bcr-abl}$ and the inhibition of p210$\rm\sp{bcr-abl}$ transforming activity by polypeptides interacting with p210$\rm\sp{bcr-abl}$ in murine myeloid 32D cells

The Bcr-Abl fusion oncogene which resulted from a balanced reciprocal translocation between chromosome 9 and 22, t(9;22)(q11, q34), encodes a 210 KD elevated tyrosine specific protein kinase that is found in more than 95 percent of chronic myelogenous leukemia patients (CML). Increase of level of phosphorylation of tyrosine is observed on cell cycle regulatory proteins in cells overexpressing the Bcr-Abl oncogene, which activates multiple signaling pathways. In addition, distinct signals are required for transforming susceptible fibroblast and hematopoietic cells, and the minimal signals essential for transforming hematopoietic cells are yet to be defined. In the present study, we first established a tetracycline repressible p210$\rm\sp{bcr-abl}$ expression system in a murine myeloid cell line 32D c13, which depends on IL3 to grow in the presence of tetracycline and proliferate independent of IL3 in the absence of tetracycline. Interestingly, one of these sublines does not form tumors in athymic nude mice suggesting that these cells may not be completely transformed. These cells also exhibit a dose-dependent growth and expression of p210$\rm\sp{bcr-abl}$ at varying concentrations of tetracycline in the culture. However, p210$\rm\sp{bcr-abl}$ rescues IL3 deprivation induced apoptosis in a non-dose dependent fashion. DNA genotoxic damage induced by gamma-irradiation activates c-Abl tyrosine kinase, the cellular homologue of p210$\rm\sp{bcr-abl},$ and leads to activation of p38 MAP kinase in the cells. However, in the presence of p210$\rm\sp{bcr-abl}$ the irradiation failed to activate the p38 MAP kinase as examined by an antibody against phosphorylated p38 MAP kinase. Similarly, an altered tyrosine phosphorylation of the JAK1-STAT1 pathways was identified in cells constitutively overexpressing p210$\rm\sp{bcr-abl}.$ This may provided a molecular mechanism for altered therapeutic response of CML patients to IFN-$\alpha.$^ Bcr-Abl oncoprotein has multiple functional domains which have been identified by the work of others. The Bcr tetramerization domain, which may function to stabilize the association of the Bcr-Abl with actin filaments in p210$\rm\sp{bcr-abl}$ susceptible cells, are essential for transforming both fibroblast and hematopoietic cells. We designed a transcription unit encoding first 160 amino acids polypeptide of Bcr protein to test if this polypeptide can inhibit the transforming activity of the p210$\rm\sp{bcr-abl}$ oncoprotein in the 32D c13 cells. When this vector was transfected transiently along with the p210$\rm\sp{bcr-abl}$ expression vector, it can block the transforming activity of p210$\rm\sp{bcr-abl}.$ On the other hand, the retinoblastoma tumor suppressor protein (Rb), a naturally occurring negative regulator of the c-Abl kinase, the cellular homologue of Bcr-Abl oncoprotein, binds to and inhibits the c-Abl kinase in a cell cycle dependent manner. A polypeptide obtained from the carboxyl terminal end of the retinoblastoma tumor suppressor protein, in which the nuclear localization signal was mutated, was used to inhibit the kinase activity of the p210$\rm\sp{bcr-abl}$ in the cytoplasm. This polypeptide, called Rb MC-box, and its wild type form, Rb C-box, when overexpressed in the 32D cells are mainly localized in the cytoplasm. Cotransfection of a plasmid transcription unit coding for this polypeptide and the gene for the p210$\rm\sp{bcr-abl}$ resulted in reduced plating efficiency of p210$\rm\sp{bcr-abl}$ transfected IL3 independent 32D cells. Together, these results may lead to a molecular approach to therapy of CML and an in vitro assay system to identify new targets to which an inhibitory polypeptide transcription unit may be directed. ^

Molecular mechanism of PUVA-induced apoptosis in mouse epidermal cells

A combination of psoralens and ultraviolet-A radiation referred to as PUVA, is widely used in the treatment of psoriasis. PUVA therapy is highly effective in killing hyperproliferative cells, but its mechanism of action has not been fully elucidated. Psoralen binds to DNA, and upon photoactivation by UVA, it forms monofunctional adducts and interstrand cross-links. PUVA treatment has been shown to be mutagenic and to produce tumors in animals. In addition, epidemiological studies have reported a 10 to 15 percent increased risk of developing squamous cell carcinoma in individuals treated chronically with PUVA. However, it remains a treatment for skin disorders such as psoriasis because its benefits outweigh its risks. The widespread use of PUVA therapy and its associated cancer risk requires us to understand the molecular mechanisms by which PUVA induces cell death. Immortalized JB6 mouse epidermal cells, p53−/− mice, and Fas Ligand−/− (gld) mice were used to investigate the molecular mechanism by which PUVA kills cells. Treatment of JB6 cells with 10 μg/ml 8-methoxypsoralen followed by irradiation with 20 kJ/m2 UVA resulted in cell death. The cells exhibited morphological and biochemical characteristics of apoptosis such as chromatin condensation, DNA ladder formation, and TUNEL-positivity. PUVA treatment stabilized and phosphorylated p53 leading to its activation, as measured by nuclear localization and induction of p21Waf/Cip1, a transcriptional target of p53. Subsequent in vivo studies revealed that there was statistically significantly less apoptosis in p53 −/− mice than in p53+/+ mice at 72 hours after PUVA. In addition, immunohistochemical analysis revealed more Fas and FasL expression in p53+/+ mice than in p53−/− mice, suggesting that p53 is required to transcriptionally activate Fas, which in turn causes the cells to undergo apoptosis. Studies with gld mice confirmed a role for Fas/FasL interactions in PUVA-induced apoptosis. There was statistically significantly less apoptosis in gld mice compared with wild-type mice 24, 48, and 72 hours after PUVA. These results demonstrate that PUVA-induced apoptosis in mouse epidermal cells requires p53 and Fas/FasL interactions. These findings may be important for designing effective treatments for diseases such as psoriasis without increasing the patient's risk for skin cancer. ^

The role of functional tumor suppressor 15-lipoxygenase 2 (15-LOX2) in normal human prostate epithelial cells and prostate cancer development

15-Lipoxygenase 2 (15-LOX2) is a recently cloned human lipoxygenase that shows tissue-restricted expression in prostate, lung, skin, and cornea. The protein level and enzymatic activity of 15-LOX2 have been shown to be down-regulated in prostate cancers compared with normal and benign prostate tissues. We report the cloning and functional characterization of 15-LOX2 and its three splice variants (termed 15-LOX2sv-a, 15-LOX2sv-b, and 15-LOX2sv-c) from primary prostate epithelial (NHP) cells. Western blotting with multiple NHP cell strains and prostate cancer (PCa) cell lines reveals that the expression of 15-LOX2 is lost in all PCa cell lines, accompanied by decreased enzymatic activity. 15-LOX2 is expressed at multiple subcellular locations, including cytoplasm, cytoskeleton, cell-cell border, and nucleus. Surprisingly, the three splice variants of 15-LOX2 are mostly excluded from the nucleus. To elucidate the relationship between nuclear localization, enzymatic activity, and tumor suppressive functions, we established PCa cell clones stably expressing 15-LOX2 or 15-LOX2sv-b. The 15-LOX2 clones express 15-LOX2 in the nuclei and possess robust enzymatic activity, whereas 15-LOX2sv-b clones show neither nuclear protein localization nor arachidonic acid-metabolizing activity. Interestingly, both 15-LOX2- and 15-LOX2sv-b-stable clones proliferate much slower in vitro when compared with control clones. When orthotopically implanted in nude mouse prostate, both 15-LOX2 and 15-LOX2sv-b suppress PC3 tumor growth in vivo. Finally, cultured NHP cells lose the expression of putative stem/progenitor cell markers, slow down in proliferation, and enter senescence. Several pieces of evidence implicate 15-LOX2 plays a role in replicative senescence of NHP cells: (1) promoter activity and the mRNA and protein levels of 15-LOX2 and its splice variants are upregulated in serially passaged NHP cells, which precede replicative senescence and occur in a cell-autonomous manner; (2) PCa cells stably expressing 15-LOX2 or 15-LOX2sv-b show a passage-related senescence-like phenotype; (3) enforced expression of 15-LOX2 or 15-LOX2sv-b in young NHP cells induce partial cell-cycle arrest and senescence-like phenotypes. Together, these results suggest that 15-LOX2 suppress prostate tumor development and do not necessarily depend on arachidonic acid-metabolizing activity and nuclear localization. Also, 15-LOX2 may serve as an endogenous prostate senescence gene and its tumor-suppressing functions might be associated with its ability to induce cell senescence. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

A role for p53 in sensing DNA damage and triggering apoptotic responses to anticancer agents

The p53 tumor suppressor protein plays a major role in cellular responses to anticancer agents that target DNA. DNA damage triggers the accumulation of p53, resulting in the transactivation of genes, which induce cell cycle arrest to allow for repair of the damaged DNA, or signal apoptosis. The exact role that p53 plays in sensing DNA damage and the functional consequences remain to be investigated. The main goal of this project was to determine if p53 is directly involved in sensing DNA damage induced by anticancer agents and in mediating down-stream cellular responses. This was tested in two experimental models of DNA damage: (1) DNA strand termination caused by anticancer nucleoside analogs and (2) oxidative DNA damage induced by reactive oxygen species (ROS). Mobility shift assays demonstrated that p53 and DNA-PK/Ku form a complex that binds DNA containing the anticancer nucleoside analog gemcitabine monophosphate in vitro. Binding of the p53-DNA-PK/Ku complex to the analog-containing DNA inhibited DNA strand elongation. Furthermore, treatment of cells with gemcitabine resulted in the induction of apoptosis, which was associated with the accumulation of p53 protein, its phosphorylation, and nuclear localization, suggesting the activation of p53 to trigger apoptosis following gemcitabine induced DNA strand termination. The role of p53 as a DNA damage sensor was further demonstrated in response to oxidative DNA damage. Protein pull-down assays demonstrated that p53 complexes with OGG1 and APE, and binds DNA containing the oxidized DNA base 8-oxoG. Importantly, p53 enhances the activities of APE and OGG1 in excising the 8-oxoG residue as shown by functional assays in vitro. This correlated with the more rapid removal of 8-oxoG from DNA in intact cells with wild-type p53 exposed to exogenous ROS stress. Interestingly, persistent exposure to ROS resulted in the accelerated onset of apoptosis in cells with wild-type p53 when compared to isogenic cells lacking p53. Apoptosis in p53+/+ cells was associated with accumulation and phosphorylation of p53 and its nuclear localization. Taken together, these results indicate that p53 plays a key role in sensing DNA damage induced by anticancer nucleoside analogs and ROS, and in triggering down-stream apoptotic responses. This study provides new mechanistic insights into the functions of p53 in cellular responses to anticancer agents. ^

The epidemiology of Hepatitis B and Hepatitis C virus infection among college students who are not US/Canadian born in Houston

Introduction. A vast majority of studies conducted in both developed and developing nations have focused on the epidemiology of HBV (Hepatitis B virus) and HCV (Hepatitis C virus) in high-risk populations; low-risk populations have been neglected. Recently Hwang et al conducted a unique large cross-sectional study in American university students that focused on cosmetic procedures and drug use for acquiring these infections among a low-risk young adult population In Houston. ^ Methods. This study is a secondary data analysis of the cross-sectional study conducted by Hwang et al. Data for this anonymous study were collected from 7,960 college students, among whom were the 2,561 non US/Canadian born students included in this study. All students completed a self-administered questionnaire and provided a blood sample. The epidemiology of HBV/HCV and risk factors for acquiring HBV/HCV infection was studied by comparing those with HBV/HCV infection versus those without. Both univariate and multivariate logistic regression was used to analyze the data. ^ Results. Overall prevalence of HBV and HCV infections were 22% and 0.8% respectively. By multivariable analysis, the factors that were independently associated with increased prevalence of HBV infection were increasing age per year (OR=1.06, 95% C.I=1.04-1.08), Black or Asian race (OR=6.21, 95% C.I=3.14-12.27), history of household contact with hepatitis (OR=1.87, 95% C.I=1.15-3.05), and having sexual partner with hepatitis (OR=5.20, 95% C.I=1.5-18.00). For HCV these factors included increasing age per year (OR= 1.08, 95% C.I=1.03-1.14), history of blood transfusion prior to 1991 (OR=25.45, 95% C.I=7.58-85.40), and Injection drug use. (OR=78.15, 95% C.I=12.19-500.85). Cosmetic procedures like tattooing were not significant risk factors for either HBV or HCV infection. ^ Conclusions. In a low-risk adult foreign born population, cosmetic procedures are not significant risk factors for HBV or HCV infection. The prevention strategies of these infections in this population should focus on safe sexual practices/abstinence and HBV vaccination should be provided to adolescents and sexually active adults. ^