Glutamate and nitric oxide as regulatory transmitters in developing rabbit retina

Glutamate is the major excitatory neurotransmitter in the retina and serves as the synaptic messenger for the three classes of neurons which constitute the vertical pathway--the photoreceptors, bipolar cells and ganglion cells. In addition, the glutamate system has been localized morphologically, pharmacologically as well as molecularly during the first postnatal week of development before synaptogenesis occurs. The role which glutamate plays in the maturing visual system is complex but ranges from mediating developmental neurotoxicity to inducing neurite outgrowth.^ Nitric oxide/cGMP is a novel intercellular messenger which is thought to act in concert with the glutamate system in regulating a variety of cellular processes in the brain as well as retina, most notably neurotoxicity. Several developmental activities including programmed cell death, synapse elimination and synaptic reorganization are possible functions of cellular regulation modulated by nitric oxide as well as glutamate.^ The purpose of this thesis is to (1) biochemically characterize the endogenous pools of glutamate and determine what fraction exists extracellularly; (2) examine the morphological expression of NO producing cells in developing retina; (3) test the functional coupling of the NMDA subtype of glutamate receptor to the NO system by examining neurotoxicity which has roles in both the maturing and adult retina.^ Biochemical sampling of perfusates collected from the photoreceptor surface of ex vivo retina demonstrated that although the total pool of glutamate present at birth is relatively modest, a high percentage resides in extracellular pools. As a result, immature neurons without significant synaptic connections survive and develop in a highly glutamatergic environment which has been shown to be toxic in the adult retina.^ The interaction of the glutamate system with the NO system has been postulated to regulate neuronal survival. We therefore examined the developmental expression of the enzyme responsible for producing NO, nitric oxide synthase (NOS), using an antibody to the constitutive form of NOS found in the brain. The neurons thought to produce the majority of NO in the adult retina, a subpopulation of widefield amacrine cells, were not immunoreactive until the end of the second postnatal week. However, a unique developmental expression was observed in the ganglion cell layer and developing outer nuclear layer of the retina during the first postnatal week. We postulate NO producing neurons may not be present in a mature configuration therefore permitting neuronal survival in a highly glutamatergic microenvironment and allowing NO to play a development-specific role at this time.^ The next set of experiments constituted a functional test of the hypothesis that the absence of the prototypic NO producing cells in developing retina protects immature neurons against glutamate toxicity. An explant culture system developed in order to examine cellular responses of immature and adult neurons to glutamate toxicity showed that immature neurons were affected by NMDA but were less responsive to NMDA and NO mediated toxicity. In contrast, adult explants exhibited significant NMDA toxicity which was attenuated by NMDA antagonists, 2-amino-5-phosphonovaleric acid (APV), dextromethorphan (Dex) and N$\rm\sp{G}$-D-methyl arginine (metARG). These results indicated that pan-retinal neurotoxicity via the NMDA receptor and/or NO activation occurred in the adult retina but was not significant in the neonate. (Abstract shortened by UMI.) ^

The role of MAPK during the activation of NK cells

Although many clinical trials investigated the use of IL-2, IL-12, and LAK in adoptive immunotherapy to treat cancer, only limited clinical success has been achieved. Better understanding of the intracellular processes that IL-2 and IL-12 utilize to generate LAK and other functions in NK cells is necessary to improve this mode of therapy. IL-2 and IL-12 stimulate extracellular signal-regulated protein kinase (ERK) and p38 MAPK in mitogen-activated T lymphocytes. The functional roles that these kinases play are still unclear. In this study, we examined whether MAPK Kinase (MKK)/ERK and/or p38 MAPK pathways are necessary for IL-2 or IL-12 to activate NK cells. We established that IL-2 activates MKK1/2/ERK pathway in freshly isolated human NK cells without any prior stimulation. Furthermore, we determined that an intact MKK/ERK pathway is necessary for IL-2 to activate NK cells to express at least four known biological responses: LAK activity, IFN-γ secretion, and CD25 and CD69 expression. Treatment of NK cells with a specific inhibitor of MKK1/2 PD98059, during the IL-2 stimulation blocked in a dose-dependent manner each of four activation parameters. Although activation of ERK was not detected in NK cells immediately after IL-12 stimulation, IL-12-induced functional activation was inhibited by the MKK1/2 inhibitor, as well. In contrast to what was observed by others in T lymphocytes, activation of p38 MAPK by IL-2 was not detected in NK cells. Additionally, a specific inhibitor of p38 MAPK (SB203850) did not inhibit IL-2-activated NK functions. These data reveal selective signaling differences between NK cells and T lymphocytes. Collectively, the data support that the MKK/ERK pathway plays a critical positive regulatory role in NK cells during activation by IL-2 and IL-12. ^

NFkappaB and STAT binding elements participate in regulation of MUC1 expression in normal and transformed mammary epithelial cells

The MUC1 gene encodes a transmembrane mucin glycoprotein that is overexpressed in several cancers of epithelial origin, including those of breast, pancreas, lung, ovary, and colon. Functions of MUC1 include protection of mucosal epithelium, modulation of cellular adhesion, and signal transduction. Aberrantly increased expression of MUC1 in cancer cells promotes tumor progression through adaptation of these functions. Some regulatory elements participating in MUC1 transcription have been described, but the mechanisms responsible for overexpression are largely unknown. A region of MUC1 5′ flanking sequence containing two conserved potential cytokine response elements, an NFκB site at −589/−580 and a STAT binding element (SBE) at −503/−495, has been implicated in high level expression in breast and pancreatic cancer cell lines. Persistent stimulation by proinflammatory cytokines may contribute to increased MUC1 transcription by tumor cells. ^ T47D breast cancer cells and normal human mammary epithelial cells (HMEC) were used to determine the roles of the κB site and SBE in basal and stimulated expression of MUC1. Treatment of T47D cells and HMEC with interferon-γ (IFNγ) alone enhanced MUC1 expression at the level of transcription, and the effect of IFNγ was further stimulated by tumor necrosis factor-α (TNFα). MUC1 responsiveness to these cytokines was modest in T47D cells but clearly evident in HMEC. Transient transfection of T47D cells with mutant MUC1 promoter constructs revealed that the κB site at −589/−580 and the SBE at −503/−495 and were required for cooperative stimulation by TNFα and IFNγ. Electrophoretic mobility shift assays (EMSA) revealed that the synergy was mediated not by cooperative binding of transcription factors but by the independent actions of STAT1α and NFκB p65 on their respective binding sites. Independent mutations in the κB site and SBE abrogated cytokine responsiveness and reduced basal MUC1 promoter activity by 45–50%. However, only the κB site appeared to be constitutively activated in T47D cells, in part by NFκB p65. These findings implicate two cytokine response elements in the 5 ′ flanking region of MUC1, specifically a κB site and a STAT binding element, in overexpression of MUC1 in breast cancer cells. ^

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

MicroRNA Regulation of Prostate Cancer Stem/Progenitor Cells and Prostate Cancer Development

Most human tumors contain a population of cells with stem cell properties, called cancer stem cells (CSCs), which are believed to be responsible for tumor establishment, metastasis, and resistance to clinical therapy. It’s crucial to understand the regulatory mechanisms unique to CSCs, so that we may design CSC-specific therapeutics. Recent discoveries of microRNA (miRNA) have provided a new avenue in understanding the regulatory mechanisms of cancer. However, how miRNAs may regulate CSCs is still poorly understood. Here, we present miRNA expression profiling in six populations of prostate cancer (PCa) stem/progenitor cells that possess distinct tumorigenic properties. Six miRNAs were identified to be commonly and differentially expressed, namely, four miRNAs (miR-34a, let-7b, miR-106a and miR-141) were under-expressed, and two miRNAs (miR-301 and miR-452) were over-expressed in the tumorigenic subsets compared to the corresponding marker-negative subpopulations. Among them, the expression patterns of miR-34, let-7b, miR-141 and miR-301 were further confirmed in the CD44+ human primary prostate cancer (HPCa) samples. We then showed that miR-34a functioned as a critical negative regulator in prostate CSCs and PCa development and metastasis. Over-expression of miR-34a in either bulk or CD44+ PCa cells significantly suppressed clonal expansion, tumor development and metastasis. Systemic delivery of miR-34a in tumor-bearing mice demonstrated a potent therapeutic effect again tumor progression and metastasis, leading to extended animal survival. Of great interest, we identified CD44 itself as a direct and relevant downstream target of miR-34a in mediating its tumor-inhibitory effects. Like miR-34a, let-7 manifests similar tumor suppressive effects in PCa cells. In addition, we observed differential mechanisms between let-7 and miR-34a on cell cycle, with miR-34a mainly inducing G1 cell-cycle arrest followed by cell senescence and let-7 inducing G2/M arrest. MiR-301, on the other hand, exerted a cell type dependent effect in regulating prostate CSC properties and PCa development. In summary, our work reveals that the prostate CSC populations display unique miRNA expression signatures and different miRNAs distinctively and coordinately regulate various aspects of CSC properties. Altogether, our results lay a scientific foundation for developing miRNA-based anti-cancer therapy.

GENOME-WIDE PROFILING UNVEILS CRITICIAL FUNCTIONS OF p53 IN HUMAN EMBRYONIC STEM CELLS

Embryonic stem cells (ESCs) possess two unique characteristics: infinite self-renewal and the potential to differentiate into almost every cell type (pluripotency). Recently, global expression analyses of metastatic breast and lung cancers revealed an ESC-like expression program or signature, specifically for cancers that are mutant for p53 function. Surprisingly, although p53 is widely recognized as the guardian of the genome, due to its roles in cell cycle checkpoints, programmed cell death or senescence, relatively little is known about p53 functions in normal cells, especially in ESCs. My hypothesis is that p53 has specific transcription regulatory functions in human ESCs (hESCs) that a) oppose pluripotency and b) protect the stem cell genome in response to DNA damage and stress signaling. In mouse ESCs, these roles are believed to coincide, as p53 promotes differentiation in response to DNA damage, but this is unexplored in hESCs. To determine the biological roles of p53, specifically in hESCs, we mapped genome-wide chromatin interactions of p53 by chromatin immunoprecipitation and massively parallel tag sequencing (ChIP-Seq), and did so under three VIdifferent conditions of hESC status: pluripotency, differentiation-initiated and DNA-damage-induced. ChIP-Seq showed that p53 is enriched at distinct, induction-specific gene loci during each of these different conditions. Microarray gene expression analysis and functional annotation of the distinct p53-target genes revealed that p53 regulates specific genes encoding developmental regulators, which are expressed in differentiation-initiated but not DNA- damaged hESCs. We further discovered that, in response to differentiation signaling, p53 binds regions of chromatin that are repressed but also poised for rapid activation by core pluripotency factors OCT4 and NANOG in pluripotent hESCs. In response to DNA damage, genes associated with migration and motility are targeted by p53; whereas, the prime targets of p53 in control of cell death are conserved for p53 regulation in both differentiation and DNA damage. Our genome-wide profiling and bioinformatics analyses show that p53 occupies a special set of developmental regulatory genes during early differentiation of hESCs and functions in an induction-specific manner. In conclusion, our research unveiled previously unknown functions of p53 in ESC biology, which augments our understanding of one of the most deregulated proteins in human cancers.

TURNOVER RATE OF THE NEURONAL CONNEXIN CX36 IN HELA CELLS

Electrical synapses formed of the gap junction protein Cx36 show a great deal of functional plasticity, much dependent on changes in phosphorylation state of the connexin. However, gap junction turnover may also be important for regulating cell-cell communication, and turnover rates of Cx36 have not been studied. Connexins have relatively fast turnover rates, with short half-lives measured to be 1.5 to 3.5 hours in pulse-chase analyses of connexins (Cx26 and Cx43) in tissue culture cells and whole organs. We utilized HaloTag technology to study the turnover rate of Cx36 in transiently transfected HeLa cells. The HaloTag protein forms irreversible covalent bonds with chloroalkane ligands, allowing pulse-chase experiments to be performed very specifically. The HaloTag open reading frame was inserted into an internal site in the C-terminus of Cx36 designed not to disrupt the regulatory phosphorylation sites and not to block the C-terminal PDZ interaction motif. Functional properties of Cx36-Halo were assessed by Neurobiotin tracer coupling, live cell imaging, and immunostaining. For the pulse-chase study, transiently transfected HeLa cells were pulse labeled with Oregon Green (OG) HaloTag ligand and chase labeled at various times with tetramethylrhodamine (TMR) HaloTag ligand. Cx36-Halo formed large junctional plaques at sites of contact between transfected HeLa cells and was also contained in a large number of intracellular vesicles. The Cx36-Halo transfected HeLa cells supported Neurobiotin tracer coupling that was regulated by activation and inhibition of PKA in the same manner as wild-type Cx36 transfected cells. In the pulse-chase study, junctional protein labeled with the pulse ligand (OG) was gradually replaced by newly synthesized Cx36 labeled with the chase ligand (TMR). The half-life for turnover of protein in junctional plaques was 2.8 hours. Treatment of the pulse-labeled cells with Brefeldin A (BFA) prevented the addition of new connexins to junctional plaques, suggesting that the assembly of Cx36 into gap junctions involves the traditional ER-Golgi-TGN-plasma membrane pathway. In conclusion, Cx36-Halo is functional and has a turnover rate in HeLa cells similar to that of other connexins that have been studied. This turnover rate is likely too slow to contribute substantially to short-term changes in coupling of neurons driven by transmitters such as dopamine, which take minutes to achieve. However, turnover may contribute to longer-term changes in coupling.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

The effect of protein tyrosine phosphatase SHP1 on tumorigenicity of the MDA -MB231 breast cancer cells

SHP1 is a cytosolic protein tyrosine phosphatase that contains two SH2 domains. It is highly expressed in hematopoietic cells and expressed in normal epithelium at lower levels. While SHP1 in hematopoietic cells is thought to be a negative regulator of cellular signaling by associating with and dephosphorylating various receptors and their downstream effectors after they become activated, its precise function in epithelium remains to be understood. The potential involvement of SHP1 in human tumorigenesis has been hypothesized from the findings that SHP1 can interact with, dephosphorylate, and regulate the activity of several protein tyrosine kinases (PTKs) implicated in human cancer. These PTKs include epidermal growth factor receptor (EGFR) and Src. Such speculation is also supported by the report that SHP1 is overexpressed in human ovarian cancers. ^ Here we report, for the first time, that the levels of SHP1 expression and activity are altered in human breast cancer cells in comparison with normal breast epithelium. In particular, SHP1 expression is nearly lost in the breast cancer cell lines MDA-MB231 and MDA-MB435. After the re-introduction of SHP1 both in wild type (wt) and enzymatically inactive (dn) forms, into the MDA-MB231 cells, we observed no changes in cellular proliferation. However, the overexpression of wt SHP1 led to increased anchorage-independent growth in the MDA-MB231 cells. SHP1 phosphatase activity is essential for such an increase since the overexpression of dn SHP1 had no effect. Enhanced turnorigenicity in nude mice was also observed in the MDA-MB231 cells overexpressing wt SHP1, but not dn SHP1, suggesting the crucial function of SHP1 enzymatic activity in this process. Our observations in this study indicate that SHP1 promotes tumorigenesis by a mechanism or mechanisms apart from enchancing angiogenesis. In addition, we have found no evidence that the overexpression of SHP1 could affect metastatic potential in the MDA-MB231 cells. ^ In the MDA-MB231 cells stably transfected with either wt or dn SHP1 the peak level of EGFR tyrosine phosphorylation induced by EGF, as well as the sensitivity to EGF stimulation, was not altered. However, the overexpression of wt SHP1 led to a slight increase in the kinetics of EGFR dephosphorylation, whereas the overexpression of dn SHP1 led to slightly delayed kinetics of EGFR dephosphorylation. The overexpression of either the wt or dn SHP1 did not lead to any significant increase in Src kinase activity. ^ In NIH3T3 cells, the transient overexpression of SHP1 led to no significant changes in MAP kinase (ERK2) activation by EGF or Akt activation by PDGF. In 3T3H4 cells, the transient overexpression of SHP1 led to no significant changes in MAP kinase (ERK2) activation by heregulin. The transient overexpression of wt SHP1 in the MDA-MB231 cells caused an apparent increase, ranging from 10% to 20%, in the G0/G1 population of the cells with a corresponding decrease in the S phase population. ^ In order to understand the mechanisms by which SHP1 exerts its positive effect on the tumorigenic potential of the MDA-MB231 cells, we employed two-dimensional electrophoresis in an attempt to identify cellular protein(s) with significantly altered tyrosine phosphorylation level upon wt SHP1 overexpression. The overexpression of wt SHP1 but not dn SHP1, leads increased tyrosine phosphorylation of a protein with a molecular weight of approximately 40 kDa and a pI between 5.9 to 6.6. ^

Intrinsic oxidative stress in cancer cells: A biochemical basis for therapeutic selectivity using ROS -generating agents

A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^