Cis-acting elements and developmental regulators govern toxin gene expression in Bacillus anthracis

Expression of the structural genes for the anthrax toxin proteins is coordinately controlled by host-related signals such as elevated CO2 , and the trans-acting positive regulator, AtxA. No specific binding of AtxA to the toxin gene promoters has been demonstrated and no sequence-based similarities are apparent in the promoter regions of toxin genes. We hypothesized that the toxin genes possess common structural features that are required for positive regulation. To test this hypothesis, I performed an extensive characterization of the toxin gene promoters. I determined the minimal sequences required for atxA-mediated toxin gene expression and compared these sequences for structural similarities. In silico modeling and in vitro experiments indicated significant curvature within these regions. Random mutagenesis revealed that point mutations associated with reduced transcriptional activity, mostly mapped to areas of high curvature. This work enabled the identification of two potential cis-acting elements implicated in AtxA-mediated regulation of the toxin genes. In addition to the growth condition requirements and AtxA, toxin gene expression is under growth phase regulation. The transition state regulator AbrB represses atxA expression to influence toxin synthesis. Here I report that toxin gene expression also requires sigH, a gene encoding the RNA polymerase sigma factor associated with development in B. subtilis. In the well-studied B. subtilis system, σH is part of a feedback control pathway that involves AbrB and the major response regulator of sporulation initiation, Spo0A. My data indicate that in B. anthracis, regulatory relationships exist between these developmental regulators and atxA . Interestingly, during growth in toxin-inducing conditions, sigH and abrB expression deviates from that described for B. subtilis, affecting expression of the atxA gene. These findings, combined with previous observations, suggest that the steady state level of atxA expression is critical for optimal toxin gene transcription. I propose a model whereby, under toxin-inducing conditions, control of toxin gene expression is fine-tuned by the independent effects of the developmental regulators on the expression of atxA . The growth condition-dependent changes in expression of these regulators may be crucial for the correct timing and uninterrupted expression of the toxin genes during infection. ^

BLyS/BAFF-R signaling pathway in human aggressive non Hodgkin's lymphoma B cell and normal peripheral blood B lymphocytes

B-lymphocyte stimulator (BLyS also called BAFF), is a potent cell survival factor expressed in many hematopoietic cells. BLyS levels are elevated in the serum of non-Hodgkin lymphoma (NHL) patients, and have been reported to be associated with disease progression, and prognosis. To understand the mechanisms involved in BLyS gene expression and regulation, we examined expression, function, and regulation of the BLyS gene in B cell non-Hodgkin's lymphoma (NHL-B) cells. BLyS is constitutively expressed in aggressive NHL-B cells including large B cell lymphoma (LBCL) and mantle cell lymphoma (MCL) contributing to survival and proliferation of malignant B cells. Two important transcription factors, NF-κB and NFAT, were found to be involved in regulating BLyS expression through at least one NF-κB and two NFAT binding sites in the BLyS promoter. Further study indicates that the constitutive activation of NF-κB and BLyS in NHL-B cells forms a positive feedback loop contributing to cell survival and proliferation. In order to further investigate BLyS signaling pathway, we studied the function of BAFF-R, a major BLyS receptor, on B cells survival and proliferation. Initial study revealed that BAFF-R was also found in the nucleus, in addition to its presence on plasma membrane of B cells. Nuclear presentation of BAFF-R can be increased by anti-IgM and soluble BLyS treatment in normal peripheral B lymphocytes. Inhibition of BLyS expression decreases nuclear BAFF-R level in LBCL cells. Furthermore, we showed that BAFF-R translocated to nucleus through the classic karyopherin pathway. A candidate nuclear localization sequence (NLS) was identified in the BAFF-R protein sequence and mutation of this putative NLS can block BAFF-R entering nucleus and LBCL cell proliferation. Further study showed that BAFF-R co-localized with NF-κB family member, c-rel in the nucleus. We also found BAFF-R mediated transcriptional activity, which could be increased by c-rel. We also found that nuclear BAFF-R could bind to the NF-κB binding site on the promoters of NF-κB target genes such as BLyS, CD154, Bcl-xL, Bfl-1/A1 and IL-8. These findings indicate that BAFF-R may also promote survival and proliferation of normal B cells and NHL-B cells by directly functioning as a transcriptional co-factor with NF-κB family member. ^

The effect of DNA methylation in carcinogenesis

CpG island methylation within single gene promoters can silence expression of associated genes. We first extended these studies to bidirectional gene pairs controlled by single promoters. We showed that hypermethylation of bidirectional promoter-associated CpG island silences gene pairs (WNT9A/CD558500, CTDSPL/BC040563, and KCNK15/BF 195580) simultaneously. Hypomethylation of these promoters by 5-aza-2'-deoxycytidine treatment reactivated or enhanced gene expression bidirectionally. These results were further confirmed by luciferase assays. Methylation of WNT9A/CD558500 and CTDSPL/BC040563 promoters occurs frequently in primary colon cancers and acute lymphoid leukemia, respectively. ^ Next we sought to understand the origins of hypermethylation in cancer. CpG islands associated with tumor suppressor genes are normally free from methylation, but can be hypermethylated in cancer. It remains poorly understood how these genes are protected from methylation in normal tissues. In our studies, we aimed to determine if cis-acting elements in these genes are responsible for this protection, using the tumor suppressor gene p16 as a model. We found that Alu repeats located both upstream and downstream of the p16 promoter become hypermethylated with age. In colon cancer samples, the methylation level is particularly high, and the promoter can also be affected. Therefore, the protection in the promoter against methylation spreading could fail during tumorigenesis. This methylation pattern in p16 was also observed in cell lines of different tissue origins, and their methylation levels were found to be inversely correlated with that of active histone modification markers (H3K4-3me and H3K9-Ac). To identify the mechanism of protection against methylation spreading, we constructed serial deletions of the p16 protected region and used silencing of a neomycin reporter gene to evaluate the protective effects of these fragments. A 126 bp element was identified within the region which exerts bidirectional protection against DNA methylation, independently of its transcriptional activity. The protective strength of this element is comparable to that of the HS4 insulator. During long-term culture, the presence of this element significantly slowed methylation spreading. In conclusion, we have found that an element located in the p16 promoter is responsible for protection against DNA methylation spreading in normal tissues. The failure of protective cis-elements may be a general feature of tumor-suppressor gene silencing during tumorigenesis. ^

The eukaryotic cellular stress response: Biochemical and genetic analyses in Saccharomyces cerevisiae

All cells must have the ability to deal with a variety of environmental stresses. Failure to correctly adapt to and/or protect against adverse stress conditions can lead to cell death. In humans, stress response defects have been linked to a number of neurodegenerative diseases and cancer, underscoring the importance of developing a fundamental understanding of the eukaryotic stress response.^ In an effort to characterize cellular response to high temperature stress, I identified and described one member of a novel gene family— RTR1. I show that the RTR1 gene and its protein product genetically and biochemically interact with core subunits of the RNA polymerase II enzyme. Appropriately, loss of RTR1 results in defective transcription from multiple promoters. These data provide evidence that Rtr1, which is essential under stress conditions, acts as a key regulator of transcription.^ In addition to transcriptional regulation, cells deal with many stressors by inducing molecular chaperones. Molecular chaperones are ubiquitous in all living cells and bind unfolded or damaged proteins and catalyze refolding or degradation. Hsp90 is a unique chaperone because it targets specific clients—typically signaling proteins—for maturation. While it has been shown that Sse1, the yeast Hsp110, is a critical regulator of the Hsp90 chaperone cycle, this work describes the molecular basis for that regulation. I show that Sse1 modulates Hsp90 function through regulation of Hsp70 nucleotide exchange. Further, Hsp110-type nucleotide exchange factors (NEFs) appear to have a specific role in modulating Hsp90 function in this manner. Finally, in addition to Hsp110, the eukaryotic cytosol contains two other types of Hsp70 NEF: Snl1 (BAG-domain protein) and Fes1 (HspBP1-like protein). I investigated the cellular roles of these NEFs to better understand the reason that eukaryotic cells contain three distinct protein families that perform the same biochemical function. I show that while cytsolic Hsp70 NEFs have some degree of functional overlap, they also exhibit striking divergence. Taken together, the work presented in this dissertation provides a more detailed understanding of the eukaryotic stress response. ^

THE USE OF ARM CIRCUMFERENCE FOR SIMPLIFIED SCREENING FOR MALNUTRITION BY MINIMALLY TRAINED HEALTH WORKERS

Because of its simplicity and low cost, arm circumference (AC) is being used increasingly in screening for protein energy malnutrition among pre-school children in many parts of the developing world, especially where minimally trained health workers are employed. The objectives of this study were as follows: (1) To determine the relationship of the AC measure with weight for age and weight for height in the detection of malnutrition among pre-school children in a Guatemalan Indian village. (2) To determine the performance of minimally trained promoters under field conditions in measuring AC, weight and height. (3) To describe the practical aspects of taking AC measures versus weight, age and height.^ The study was conducted in San Pablo La Laguna, one of four villages situated on the shores of Lake Atitlan, Guatemala, in which a program of simplified medical care was implemented by the Institute for Nutrition for Central America and Panama (INCAP). Weight, height, AC and age data were collected for 144 chronically malnourished children. The measurements obtained by the trained investigator under the controlled conditions of the health post were correlated against one another and AC was found to have a correlation with weight for age of 0.7127 and with weight for height of 0.7911, both well within the 0.65 to 0.80 range reported in the literature. False positive and false negative analysis showed that AC was more sensitive when compared with weight for height than with weight for age. This was fortunate since, especially in areas with widespread chronic malnutrition, weight for height detects those acute cases in immediate danger of complicating illness or death. Moreover, most of the cases identified as malnourished by AC, but not by weight for height (false positives), were either young or very stunted which made their selection by AC better than weight for height. The large number of cases detected by weight for age, but not by AC (false negative rate--40%) were, however, mostly beyond the critical age period and had normal weight for heights.^ The performance of AC, weight for height and weight for age under field conditions in the hands of minimally trained health workers was also analyzed by correlating these measurements against the same criterion measurements taken under ideally controlled conditions of the health post. AC had the highest correlation with itself indicating that it deteriorated the least in the move to the field. Moreover, there was a high correlation between AC in the field and criterion weight for height (0.7509); this correlation was almost as high as that for field weight for height versus the same measure in the health post (0.7588). The implication is that field errors are so great for the compounded weight for height variable that, in the field, AC is about as good a predictor of the ideal weight for height measure.^ Minimally trained health workers made more errors than the investigator as exemplified by their lower intra-observer correlation coefficients. They consistently measured larger than the investigator for all measures. Also there was a great deal of variability between these minimally trained workers indicating that careful training and followup is necessary for the success of the AC measure.^ AC has many practical advantages compared to the other anthropometric tools. It does not require age data, which are often unreliable in these settings, and does not require sophisticated subtraction and two dimensional table-handling skills that weight for age and weight for height require. The measure is also more easily applied with less disturbance to the child and the community. The AC tape is cheap and not easily damaged or jarred out of calibration while being transported in rugged settings, as is often the case with weight scales. Moreover, it can be kept in a health worker's pocket at all times for continual use in a widespread range of settings. ^

Provider perceptions of physical activity counseling: A systematic review

Background: Although the health benefits of physical activity are well-established, the evidence regarding the efficacy of physical activity counseling by primary care providers is inconclusive. Healthy People 2020 recommends that physicians provide counseling on physical activity to their patients; however, few providers adhere to these guidelines. The primary objective of this review is to systematically summarize and evaluate primary care providers' perceptions and attitudes about physical activity counseling. ^ Methods: A systematic literature search of relevant articles was conducted between January and May 2011 using four databases: MEDLINE (1948 to the present), PsycInfo (1806 to the present), CINAHL Plus with Full Text (1981 to the present), and the Cochrane Library. Studies were included if 1) the study population consisted of primary care providers and, 2) the study evaluated providers' attitudes and perceptions pertaining to physical activity counseling. Both quantitative and studies were considered. ^ Results: Most primary care providers agree that physical activity counseling is important and that they have a role in promoting physical activity to their patients. Providers are uncertain about the effectiveness of counseling, feel only marginally comfortable providing more than general advice about physical activity, and cite major barriers to counseling such as lack of time, lack of training, and lack of reimbursement for their counseling efforts. The evidence in this review suggests that beyond these barriers, providers are more likely to counsel their patients about physical activity if they are active themselves, or if they feel that their patients' condition, such as cardiovascular disease or obesity, would strongly benefit from a lifestyle change. ^ Conclusion: While major barriers to physical activity counseling, such as lack of time for counseling and lack of counseling knowledge still exist, primary care providers are receptive to the idea of acting as physical activity promoters in their clinical practices. However, the barriers encountered need to be addressed on multiple levels (e.g. individual, organizational), and additional training is needed in order for providers to effectively promote the physical activity of their patients.^

TAZ AS A REGULATOR OF MESENCHYMAL TRANSFORMATION AND CLINICAL AGGRESSIVENESS IN GLIOMAS

Glioblastoma multiforme (GBM) is an aggressive, high grade brain tumor. Microarray studies have shown a subset of GBMs with a mesenchymal gene signature. This subset is associated with poor clinical outcome and resistance to treatment. To establish the molecular drivers of this mesenchymal transition, we correlated transcription factor expression to the mesenchymal signature and identified transcriptional co-activator with PDZ-binding motif (TAZ) to be highly associated with the mesenchymal shift. High TAZ expression correlated with worse clinical outcome and higher grade. These data led to the hypothesis that TAZ is critical to the mesenchymal transition and aggressive clinical behavior seen in GBM. We investigated the expression of TAZ, its binding partner TEAD, and the mesenchymal marker FN1 in human gliomas. Western analyses demonstrated increased expression of TAZ, TEAD4, and FN1 in GBM relative to lower grade gliomas. We also identified CpG islands in the TAZ promoter that are methylated in most lower grade gliomas, but not in GBMs. TAZ-methylated glioma stem cell (GSC) lines treated with a demethylation agent showed an increase in mRNA and protein TAZ expression; therefore, methylation may be another novel way TAZ is regulated since TAZ is epigenetically silenced in tumors with a better clinical outcome. To further characterize the role of TAZ in gliomagenesis, we stably silenced or over-expressed TAZ in GSCs. Silencing of TAZ decreased invasion, self-renewal, mesenchymal protein expression, and tumor-initiating capacity. Over-expression of TAZ led to an increase in invasion, mesenchymal protein expression, mesenchymal differentiation, and tumor-initiating ability. These actions are dependent on TAZ interacting with TEAD since all these effects were abrogated with TAZ could not bind to TEAD. We also show that TAZ and TEAD directly bind to mesenchymal gene promoters. Thus, TAZ-TEAD interaction is critically important in the mesenchymal shift and in the aggressive clinical behavior of GBM. We identified TAZ as a regulator of the mesenchymal transition in gliomas. TAZ could be used as a biomarker to both estimate prognosis and stratify patients into clinically relevant subgroups. Since mesenchymal transition is correlated to tumor aggressiveness, strategies to target and inhibit TAZ-TEAD and the downstream gene targets may be warranted in alternative treatment.

Functional Characterization of AtxA, the Bacillus anthracis Virulence Regulator

Coordinated expression of virulence genes in Bacillus anthracis occurs via a multi-faceted signal transduction pathway that is dependent upon the AtxA protein. Intricate control of atxA gene transcription and AtxA protein function have become apparent from studies of AtxA-induced synthesis of the anthrax toxin proteins and the poly-D-glutamic acid capsule, two factors with important roles in B. anthracis pathogenesis. The amino-terminal region of the AtxA protein contains winged-helix (WH) and helix-turn-helix (HTH) motifs, structural features associated with DNA-binding. Using filter binding assays, I determined that AtxA interacted non-specifically at a low nanomolar affinity with a target promoter (Plef) and AtxA-independent promoters. AtxA also contains motifs associated with phosphoenolpyruvate: sugar phosphotransferase system (PTS) regulation. These PTS-regulated domains, PRD1 and PRD2, are within the central amino acid sequence. Specific histidines in the PRDs serve as sites of phosphorylation (H199 and H379). Phosphorylation of H199 increases AtxA activity; whereas, H379 phosphorylation decreases AtxA function. For my dissertation, I hypothesized that AtxA binds target promoters to activate transcription and that DNA-binding activity is regulated via structural changes within the PRDs and a carboxy-terminal EIIB-like motif that are induced by phosphorylation and ligand binding. I determined that AtxA has one large protease-inaccessible domain containing the PRDs and the carboxy-terminal end of the protein. These results suggest that AtxA has a domain that is distinct from the putative DNA-binding region of the protein. My data indicate that AtxA activity is associated with AtxA multimerization. Oligomeric AtxA was detected when co-affinity purification, non-denaturing gel electrophoresis, and bis(maleimido)hexane (BMH) cross-linking techniques were employed. I exploited the specificity of BMH for cysteine residues to show that AtxA was cross-linked at C402, implicating the carboxy-terminal EIIB-like region in protein-protein interactions. In addition, higher amounts of the cross-linked dimeric form of AtxA were observed when cells were cultured in conditions that promote toxin gene expression. Based on the results, I propose that AtxA multimerization requires the EIIB-like motif and multimerization of AtxA positively impacts function. I investigated the role of the PTS in the function of AtxA and the impact of phosphomimetic residues on AtxA multimerization. B. anthracis Enzyme I (EI) and HPr did not facilitate phosphorylation of AtxA in vitro. Moreover, markerless deletion of ptsHI in B. anthracis did not perturb AtxA function. Taken together, these results suggest that proteins other than the PTS phosphorylate AtxA. Point mutations mimicking phosphohistidine (H to D) and non-phosphorylated histidine (H to A) were tested for an impact on AtxA activity and multimerization. AtxA H199D, AtxA H199A, and AtxA H379A displayed multimerization phenotypes similar to that of the native protein, whereas AtxA H379D was not susceptible to BMH cross-linking or co-affinity purification with AtxA-His. These data suggest that phosphorylation of H379 may decrease AtxA activity by preventing AtxA multimerization. Overall, my data support the following model of AtxA function. AtxA binds to target gene promoters in an oligomeric state. AtxA activity is increased in response to the host-related signal bicarbonate/CO2 because this signal enhances AtxA multimerization. In contrast, AtxA activity is decreased by phosphorylation at H379 because multimerization is inhibited. Future studies will address the interplay between bicarbonate/CO2 signaling and phosphorylation on AtxA function.

REGULATION OF ALTERNATIVE CARBON METABOLISM IN CANDIDA ALBICANS

Candida albicans is the most important fungal pathogen of humans. Transcript profiling studies show that upon phagocytosis by macrophages, C. albicans undergoes a massive metabolic reorganization activating genes involved in alternative carbon metabolism, including the glyoxylate cycle, β-oxidation and gluconeogenesis. Mutations in key enzymes such as ICL1 (glyoxylate cycle) and FOX2 (fatty acid β-oxidation) revealed that alternative carbon metabolic pathways are required for full virulence in C. albicans. These studies indicate C. albicans uses non-preferred carbon sources allowing its adaptation to microenvironments were nutrients are scarce. It has become apparent that the regulatory networks required for regulation of alternative carbon metabolism in C. albicans are considerably different from the Saccharomyces cerevisiae paradigm and appear more analogous to the Aspergillus nidulans systems. Well-characterized transcription factors in S. cerevisiae have no apparent phenotype or are missing in C. albicans. CTF1 was found to be a single functional homolog of the A. nidulans FarA/FarB proteins, which are transcription factors required for fatty acid utilization. Both FOX2 and ICL1 were found to be part of a large CTF1 regulon. To increase our understanding of how CTF1 regulates its target genes, including whether regulation is direct or indirect, the FOX2 and ICL1 promoter regions were analyzed using a combination of bioinformatics and promoter deletion analysis. To begin characterizing the FOX2 and ICL1 promoters, 5’ rapid amplification of cDNA ends (5’RACE) was used to identify two transcriptional initiation sites in FOX2 and one in ICL1. GFP reporter assays show FOX2 and ICL1 are rapidly expressed in the presence of alternative carbon sources. Both FOX2 and ICL1 harbor the CCTCGG sequence known to be bound by the Far proteins, hence rendering the motif as a putative CTF1 DNA binding element. In this study, the CCTCGG sequence was found to be essential for FOX2 regulation. However, this motif does not appear to be equally important for the regulation of ICL1. This study supports the notion that although C. albicans has diverged from the paradigms of model fungi, C. albicans has made specific adaptations to its transcription-based regulatory network that may contribute to its metabolic flexibility.

Regulation of the heat shock response by thiol-reactive compounds in the yeast Saccharomyces cerevisiae

Cells govern their activities and modulate their interactions with the environment to achieve homeostasis. The heat shock response (HSR) is one of the most well studied fundamental cellular responses to environmental and physiological challenges, resulting in rapid synthesis of heat shock proteins (HSPs), which serve to protect cellular constituents from the deleterious effects of stress. In addition to its role in cytoprotection, the HSR also influences lifespan and is associated with a variety of human diseases including cancer, aging and neurodegenerative disorders. In most eukaryotes, the HSR is primarily mediated by the highly conserved transcription factor HSF1, which recognizes target hsp genes by binding to heat shock elements (HSEs) in their promoters. In recent years, significant efforts have been made to identify small molecules as potential pharmacological activators of HSF1 that could be used for therapeutic benefit in the treatment of human diseases relevant to protein conformation. However, the detailed mechanisms through which these molecules drive HSR activation remain unclear. In this work, I utilized the baker's yeast Saccharomyces cerevisiae as a model system to identify a group of thiol-reactive molecules including oxidants, transition metals and metalloids, and electrophiles, as potent activators of yeast Hsf1. Using an artificial HSE-lacZ reporter and the glucocorticoid receptor system (GR), these diverse thiol-reactive compounds are shown to activate Hsf1 and inhibit Hsp90 chaperone complex activity in a reciprocal, dose-dependent manner. To further understand whether cells sense these reactive compounds through accumulation of unfolded proteins, the proline analog azetidine-2-carboxylic acid (AZC) and protein cross-linker dithiobis(succinimidyl propionate) (DSP) were used to force misfolding of nascent polypeptides and existing cytosolic proteins, respectively. Both unfolding reagents display kinetic HSP induction profiles dissimilar to those generated by thiol-reactive compounds. Moreover, AZC treatment leads to significant cytotoxicity, which is not observed in the presence of the thiol-reactive compounds at the concentrations sufficient to induce Hsf1. Additionally, DSP treatment has little to no effect on Hsp90 functions. Together with the ultracentrifugation analysis of cell lysates that detected no insoluble protein aggregates, my data suggest that at concentrations sufficient to induce Hsf1, thiol-reactive compounds do not induce the HSR via a mechanism based on accumulation of unfolded cytosolic proteins. Another possibility is that thiol-reactive compounds may influence aspects of the protein quality control system such as the ubiquitin-proteasome system (UPS). To address this hypothesis, β-galactosidase reporter fusions were used as model substrates to demonstrate that thiol-reactive compounds do not inhibit ubiquitin activating enzymes (E1) or proteasome activity. Therefore, thiol-reactive compounds do not activate the HSR by inhibiting UPS-dependent protein degradation. I therefore hypothesized that these molecules may directly inactivate protein chaperones, known as repressors of Hsf1. To address this possibility, a thiol-reactive biotin probe was used to demonstrate in vitro that the yeast cytosolic Hsp70 Ssa1, which partners with Hsp90 to repress Hsf1, is specifically modified. Strikingly, mutation of conserved cysteine residues in Ssa1 renders cells insensitive to Hsf1 activation by cadmium and celastrol but not by heat shock. Conversely, substitution with the sulfinic acid and steric bulk mimic aspartic acid led to constitutive activation of Hsf1. Cysteine 303, located in the nucleotide-binding/ATPase domain of Ssa1, was shown to be modified in vivo by a model organic electrophile using Click chemistry technology, verifying that Ssa1 is a direct target for thiol-reactive compounds through adduct formation. Consistently, cadmium pretreatment promoted cells thermotolerance, which is abolished in cells carrying SSA1 cysteine mutant alleles. Taken together, these findings demonstrate that Hsp70 acts as a sensor to induce the cytoprotective heat shock response in response to environmental or endogenously produced thiol-reactive molecules and can discriminate between two distinct environmental stressors.

A Novel Mechanism of Skin Tumor Promotion Involving Interferon-gamma (IFNγ)/Signal Transducer and Activator of Transcription-1 (Stat1) Signaling in Epidermis

The JAK-STAT pathway is a major signaling pathway involved in many biological processes including proliferation, apoptosis, and differentiation. Aberrant expression of STATs has been reported in multiple human cancers and murine mouse models of tumorigenesis. Previous studies from our lab and others have established a critical role for Stat3 in epithelial tumorigenesis, but the role of Stat1 is largely unknown. The current study was designed to explore the role of Stat1 during multistage skin carcinogenesis. Topical treatment with both TPA and the anthrone derivative chrysarobin (CHRY) led to rapid phosphorylation of Stat1 on both tyrosine (Tyr701) and serine (Ser727) residues in epidermis. CHRY treatment also led to upregulation of unphosphorylated Stat1 (uStat1) at later time points. In addition, CHRY treatment also led to upregulation of IRF-1 mRNA and protein which was dependent on Stat1. Further analyses demonstrated that topical treatment with CHRY but not TPA upregulated interferon-gamma (IFNg) mRNA in the epidermis and that the induction of both IRF-1 and uStat1 was dependent on IFNg signaling. Stat1 deficient (Stat1-/-) mice were highly resistant to skin tumor promotion by CHRY. In contrast, the tumor response (in terms of both papillomas and squamous cell carcinomas) was similar in Stat1-/- mice and wild-type littermates with TPA as the promoter. Histological evaluation of the proliferative response confirmed the data obtained from the tumor study for both TPA and CHRY. In addition, maximal induction of both cyclooxygenase-2 and inducible nitric oxide synthase in epidermis following treatment with CHRY was also dependent on the presence of functional Stat1. Following CHRY treatment, Stat1-/- mice exhibited reduced macrophage infiltration and reduced production of many immune cell derived chemokines/cytokines. These studies define a novel mechanism associated with skin tumor promotion by the anthrone class of tumor promoters involving upregulation of IFNg signaling in the epidermis and downstream signaling through activated (phosphorylated) Stat1 and subsequent upregulation of IRF-1 and uStat1.

The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Minimal DNA sequences that control the cell lineage-specific expression of the pro$\alpha$2(I) collagen promoter in transgenic mice

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Mechanism of subunit interaction and DNA binding of the heterotrimeric CCAAT binding factor CBF

Many eukaryotic promoters contain a CCAAT element at a site close ($-$80 to $-$120) to the transcription initiation site. CBF (CCAAT Binding Factor), also called NF-Y and CP1, was initially identified as a transcription factor binding to such sites in the promoters of the Type I collagen, albumin and MHC class II genes. CBF is a heteromeric transcription factor and purification and cloning of two of the subunits, CBF-A and CBF-B revealed that it was evolutionarily conserved with striking sequence identities with the yeast polypeptides HAP3 and HAP2, which are components of a CCAAT binding factor in yeast. Recombinant CBF-A and CBF-B however failed to bind to DNA containing CCAAT sequences. Biochemical experiments led to the identification of a third subunit, CBF-C which co-purified with CBF-A and complemented the DNA binding of recombinant CBF-A and CBF-B. We have recently isolated CBF-C cDNAs and have shown that bacterially expressed purified CBF-C binds to CCAAT containing DNA in the presence of recombinant CBF-A and CBF-B. Our experiments also show that a single molecule each of all the three subunits are present in the protein-DNA complex. Interestingly, CBF-C is also evolutionarily conserved and the conserved domain between CBF-C and its yeast homolog HAP5 is sufficient for CBF-C activity. Using GST-pulldown experiments we have demonstrated the existence of protein-protein interaction between CBF-A and CBF-C in the absence of CBF-B and DNA. CBF-B on other hand, requires both CBF-A and CBF-C to form a ternary complex which then binds to DNA. Mutational studies of CBF-A have revealed different domains of the protein which are involved in CBF-C interaction and CBF-B interaction. In addition, CBF-A harbors a domain which is involved in DNA recognition along with CBF-B. Dominant negative analogs of CBF-A have also substantiated our initial observation of assembly of CBF subunits. Our studies define a novel DNA binding structure of heterotrimeric CBF, where the three subunits of CBF follow a particular pathway of assembly of subunits that leads to CBF binding to DNA and activating transcription. ^