The role of functional tumor suppressor 15-lipoxygenase 2 (15-LOX2) in normal human prostate epithelial cells and prostate cancer development

15-Lipoxygenase 2 (15-LOX2) is a recently cloned human lipoxygenase that shows tissue-restricted expression in prostate, lung, skin, and cornea. The protein level and enzymatic activity of 15-LOX2 have been shown to be down-regulated in prostate cancers compared with normal and benign prostate tissues. We report the cloning and functional characterization of 15-LOX2 and its three splice variants (termed 15-LOX2sv-a, 15-LOX2sv-b, and 15-LOX2sv-c) from primary prostate epithelial (NHP) cells. Western blotting with multiple NHP cell strains and prostate cancer (PCa) cell lines reveals that the expression of 15-LOX2 is lost in all PCa cell lines, accompanied by decreased enzymatic activity. 15-LOX2 is expressed at multiple subcellular locations, including cytoplasm, cytoskeleton, cell-cell border, and nucleus. Surprisingly, the three splice variants of 15-LOX2 are mostly excluded from the nucleus. To elucidate the relationship between nuclear localization, enzymatic activity, and tumor suppressive functions, we established PCa cell clones stably expressing 15-LOX2 or 15-LOX2sv-b. The 15-LOX2 clones express 15-LOX2 in the nuclei and possess robust enzymatic activity, whereas 15-LOX2sv-b clones show neither nuclear protein localization nor arachidonic acid-metabolizing activity. Interestingly, both 15-LOX2- and 15-LOX2sv-b-stable clones proliferate much slower in vitro when compared with control clones. When orthotopically implanted in nude mouse prostate, both 15-LOX2 and 15-LOX2sv-b suppress PC3 tumor growth in vivo. Finally, cultured NHP cells lose the expression of putative stem/progenitor cell markers, slow down in proliferation, and enter senescence. Several pieces of evidence implicate 15-LOX2 plays a role in replicative senescence of NHP cells: (1) promoter activity and the mRNA and protein levels of 15-LOX2 and its splice variants are upregulated in serially passaged NHP cells, which precede replicative senescence and occur in a cell-autonomous manner; (2) PCa cells stably expressing 15-LOX2 or 15-LOX2sv-b show a passage-related senescence-like phenotype; (3) enforced expression of 15-LOX2 or 15-LOX2sv-b in young NHP cells induce partial cell-cycle arrest and senescence-like phenotypes. Together, these results suggest that 15-LOX2 suppress prostate tumor development and do not necessarily depend on arachidonic acid-metabolizing activity and nuclear localization. Also, 15-LOX2 may serve as an endogenous prostate senescence gene and its tumor-suppressing functions might be associated with its ability to induce cell senescence. ^

Proteomic identification and functional characterization of prohibitin 1 and 2 in T cell activation, expansion, survival and disease

Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

A role for p53 in sensing DNA damage and triggering apoptotic responses to anticancer agents

The p53 tumor suppressor protein plays a major role in cellular responses to anticancer agents that target DNA. DNA damage triggers the accumulation of p53, resulting in the transactivation of genes, which induce cell cycle arrest to allow for repair of the damaged DNA, or signal apoptosis. The exact role that p53 plays in sensing DNA damage and the functional consequences remain to be investigated. The main goal of this project was to determine if p53 is directly involved in sensing DNA damage induced by anticancer agents and in mediating down-stream cellular responses. This was tested in two experimental models of DNA damage: (1) DNA strand termination caused by anticancer nucleoside analogs and (2) oxidative DNA damage induced by reactive oxygen species (ROS). Mobility shift assays demonstrated that p53 and DNA-PK/Ku form a complex that binds DNA containing the anticancer nucleoside analog gemcitabine monophosphate in vitro. Binding of the p53-DNA-PK/Ku complex to the analog-containing DNA inhibited DNA strand elongation. Furthermore, treatment of cells with gemcitabine resulted in the induction of apoptosis, which was associated with the accumulation of p53 protein, its phosphorylation, and nuclear localization, suggesting the activation of p53 to trigger apoptosis following gemcitabine induced DNA strand termination. The role of p53 as a DNA damage sensor was further demonstrated in response to oxidative DNA damage. Protein pull-down assays demonstrated that p53 complexes with OGG1 and APE, and binds DNA containing the oxidized DNA base 8-oxoG. Importantly, p53 enhances the activities of APE and OGG1 in excising the 8-oxoG residue as shown by functional assays in vitro. This correlated with the more rapid removal of 8-oxoG from DNA in intact cells with wild-type p53 exposed to exogenous ROS stress. Interestingly, persistent exposure to ROS resulted in the accelerated onset of apoptosis in cells with wild-type p53 when compared to isogenic cells lacking p53. Apoptosis in p53+/+ cells was associated with accumulation and phosphorylation of p53 and its nuclear localization. Taken together, these results indicate that p53 plays a key role in sensing DNA damage induced by anticancer nucleoside analogs and ROS, and in triggering down-stream apoptotic responses. This study provides new mechanistic insights into the functions of p53 in cellular responses to anticancer agents. ^

Searching for the ideal DNA recognition code of covalent ligands

The combitiatorial approach restriction endonuclease protection selection and amplification REPSA was successfully used to determine ideal DNA interactions sites of covalent ligands. Unlike most other combinatorial methods, REPSA is based on inhibition of enzymatic cleavage by specific ligand-DNA complexes, which enables identification of binding sites of various ligands. However, the inherent nature of this technique posses a problem during selection of binding sites of covalent ligands. By modifying the technique according to the nature of the ligand, we demonstrate the flexibility of REPSA in identifying the preferred binding sites for monocovalent ligands, topoisomerase I and tallimustine, and the bicovalent ligand topoisomerase II. From among the preferred binding sites, we identified the consensus binding sequence of camptothecin induced topoisomerase I cleavage as ‘aGWT/Gc’, and tallimustine consensus sequences as ‘GTTCTA’ and ‘TTTTTTC’. We have shown for the first time that preferential binding of tallimustine occurs at sequences not previously reported. Furthermore, our data indicate that tallimustine is a novel DNA minor groove, guanine-specific alkylating agent. ^ Additionally, we have demonstrated in vivo that sequence-specific covalent DNA-binding small molecules have the ability to regulate transcription by inhibiting RNA polymerase II. Tallimustine, binding to its preferred sequences located in the 5′ untranslated region were an effective impediment for transcribing polymerase II. The ability of covalent binding small molecules to target predetermined DNA sequences located downstream of the promoter suggests a general approach for regulation of gene expression. ^