25 resultados para myogenin promoter


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Myogenin is a muscle-specific transcription factor essential for skeletal muscle differentiation. A severe reduction in the number of fused myotubes is seen in myogenin-null mice, and the expression of genes characteristic of differentiated skeletal muscle is reduced. Additionally, sternebrae defects are seen in myogenin-null mice, a secondary defect in the sternal cartilage precursors. Very little is known about the quantitative requirement for myogenin in muscle differentiation and thoracic skeletal development in vivo. In this thesis I describe experiments utilizing a mouse line harboring a hypomorphic allele of myogenin, generated by gene targeting techniques in embryonic stem cells. The nature of the hypomorphism was due to lowered levels of myogenin from this allele. In embryos homozygous for the hypomorphic allele, normal sternum formation and extensive muscle differentiation was observed. However, muscle hypoplasia and reduced muscle-specific gene expression were apparent in these embryos, and the mice were not viable after birth. These results suggest skeletal muscle differentiation is highly sensitive to the absolute amounts of myogenin, and reveal distinct threshold requirements for myogenin in skeletal muscle differentiation, sternum formation, and viability in vivo. The hypomorphic allele was utilized as a genetically sensitized background to identify other components of myogenin-mediated processes. Using a candidate gene approach I crossed null mutations in MEF2C and MRF4 into the hypomorphic background and examined whether these mutations affected muscle differentiation and skeleton formation in the myogenin hypomorph. Although MEF2C mutation did not affect any phenotypes seen in the hypomorphic background, MRF4 was observed to be an essential component of myogenin-mediated processes of thoracic skeletal development. Additionally, the hypomorphic allele was very sensitive to genetic effects, suggesting the existence of mappable genetic modifiers of the hypomorphic allele of myogenin. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although mechanisms regulating the formation of embryonic skeletal muscle are well characterized, less is known about muscle formation in postnatal life. This disparity is unfortunate because the largest increases in skeletal muscle mass occur after birth. Adult muscle stem cells (satellite cells) appear to recapitulate the events that occur in embryonic myoblasts. In particular, the myogenic basic helix-loop-helix factors, which have crucial functions in embryonic muscle development, are assumed to have similar roles in postnatal muscle formation. Here, I test this assumption by determining the role of the myogenic regulator myogenin in postnatal life. Myogenin-null mice die at birth, necessitating the generation of floxed alleles of myogenin and the use of cre-recombinase lines to delete myogenin. Removing myogenin before embryonic muscle development resulted in myofiber deficiencies identical to those observed in myogenin-null mice. However, mice in which myogenin was deleted following embryonic muscle development had normal skeletal muscle, except for modest alterations in MRF4 and MyoD expression. Notably, myogenin-deleted mice were 30% smaller than controls, suggesting that myogenin's absence disrupted general body growth. These results suggest that skeletal muscle growth in postnatal life is controlled by mechanisms distinct from those occurring in embryonic muscle development. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Over-expression of the receptor tyrosine kinase ErbB2 is prevalent in approximately 30% of human breast carcinomas and confers Taxol resistance. In breast cancer cells, Taxol induces tubulin polymerization and hyperstable microtubule formation. This in turn prematurely activates Cdc2 kinase allowing early entry into the G2/M phase of the cell cycle resultant in mitotic catastrophe followed by apoptosis. Over-expression of ErbB2 upregulates p21Cip1, which inhibits Cdc2 activation, and leads to Taxol resistance in patients. However, the mechanism of ErbB2-mediated p21 Cip1 upregulation is unclear. Here in this study, we investigated the mechanism of ErbB2 downstream signaling events leading to upregulation. The CDKN1A (p21Cip1) gene promoter contains numerous cis-elements including a Signal transducer and activator of transcription (STAT) Inducable Element (SIE) located at -679 kb. Our studies showed ErbB2 overexpressing cells had increased activated levels of STAT3, and therefore we hypothesized that STAT3 is responsible for the upregulation of the p21Cip1 promoter by ErbB2. EMSA and ChIP assays confirmed the binding of STAT3 to the p21Cip1 promoter and luciferase assays showed higher p21 Cip1 promoter activity in ErbB2 over-expressing transfectants when compared to parental cells, in a STAT3 binding site dependant manner. Additionally, reduced level of STAT3 led to reduced p21Cip1 protein expression and promoter activity indicating that both the STAT3 binding site and STAT3 protein are required for ErbB2-mediated p21Cip1 upregulation. Further investigation of ErbB2 downstream signaling showed increased Src kinase activity in ErbB2 over-expressing cells which was required for ErbB2-mediated STAT3 activation and p21Cip1 increase. Treatment of ErbB2 over-expressing resistant cells with STAT3 inhibitor peptides sensitized the cells to Taxol. In addition to classical signal transduction pathways, I identified a novel ErbB2 mediated regulatory mechanism of p21Cip1. I found that a nuclear ErbB2 and STAT3 complex binds directly to the p21Cip1 promoter offering a non-classical mechanism of p21Cip1 promoter regulation. These data suggest that ErbB2 over-expression can confer Taxol resistance of breast cancer cells by transcriptional upregulation of p21 Cip1 via activation of STAT3 by Src kinase and also by cooperation with nuclear ErbB2. The data suggest a potential clinical mechanism for STAT3 inhibitors in sensitizing ErbB2 over-expressing breast cancers to Taxol. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

TGF-β plays an important role in differentiation and tissue morphogenesis as well as cancer progression. However, the role of TGF-β in cancer is complicate. TGF-β has primarily been recognized as tumor suppressor, because it can directly inhibit cell proliferation of normal and premalignant epithelial cell. However, in the last stage of tumor progression, TGF-β functions as tumor promoter to enhance tumor cells metastatic dissemination and expands metastatic colonies. Currently, the mechanism of how TGF-β switches its role from tumor suppressor to promoter still remains elusive. Here we identify that overexpression of 14-3-3ζ inhibits TGF-β’s cell cytostatic program through destabilizing p53 in non-transformed human mammary epithelial cells. Mechanistically, we found that 14-3-3ζ overexpression leads to 14-3-3σ downregulation, thereby activates PI3K/Akt signaling pathway and degrades p53, and further inhibits TGF-β induced p21 expression and cell cytostatic function. In addition, we found that overexpression of 14-3-3ζ promotes TGF-β induced breast cancer cells bone metastatic colonization through stabilizing Gli2, which is an important co-transcriptional factor for p-smad2 to activate PTHrP expression and bone osteolytic effect. Taken together, we reveal a novel mechanism that 14-3-3ζ dictates the tumor suppressor or metastases promoter activities of TGF-β signaling pathway through switching p-smad2 binding partner from p53 to Gli2. The expected results will not only provide us the better understanding of the important role of 14-3-3ζ in the early stage of breast cancer development, but also deeply impact our knowledge of signaling mechanisms underlying the complex roles of TGF-β in cancer, which will give us a more accurate strategy to determine when and how anti-TGF-β targeted therapy might be effective.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^

Relevância:

20.00% 20.00%

Publicador:

Resumo:

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^