29 resultados para coordination between regulatory programs


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background. In over 30 years, the prevalence of overweight for children and adolescents has increased across the United States (Barlow et al., 2007; Ogden, Flegal, Carroll, & Johnson, 2002). Childhood obesity is linked with adverse physiological and psychological issues in youth and affects ethnic/minority populations in disproportionate rates (Barlow et al., 2007; Butte et al., 2006; Butte, Cai, Cole, Wilson, Fisher, Zakeri, Ellis, & Comuzzie, 2007). More importantly, overweight in children and youth tends to track into adulthood (McNaughton, Ball, Mishra, & Crawford, 2008; Ogden et al., 2002). Childhood obesity affects body functions such as the cardiovascular, respiratory, gastrointestinal, and endocrine systems, including emotional health (Barlow et al., 2007, Ogden et al., 2002). Several dietary factors have been associated with the development of obesity in children; however, these factors have not been fully elucidated, especially in ethnic/minority children. In particular, few studies have been done to determine the effects of different meal patterns on the development of obesity in children. Purpose. The purpose of the study is to examine the relationships between daily proportions of energy consumed and energy derived from fat across breakfast, lunch, dinner, and snack, and obesity among Hispanic children and adolescents. Methods. A cross-sectional design was used to evaluate the relationship between dietary patterns and overweight status in Hispanic children and adolescents 4-19 years of age who participated in the Viva La Familia Study. The goal of the Viva La Familia Study was to evaluate genetic and environmental factors affecting childhood obesity and its co-morbidities in the Hispanic population (Butte et al., 2006, 2007). The study enrolled 1030 Hispanic children and adolescents from 319 families and examined factors related to increased body weight by focusing on a multilevel analysis of extensive sociodemographic, genetic, metabolic, and behavioral data. Baseline dietary intakes of the children were collected using 24-hour recalls, and body mass index was calculated from measured height and weight, and classified using the CDC standards. Dietary data were analyzed using a GEE population-averaged panel-data model with a cluster variable family identifier to include possible correlations within related data sets. A linear regression model was used to analyze associations of dietary patterns using possible covariates, and to examine the percentage of daily energy coming from breakfast, lunch, dinner, and snack while adjusting for age, sex, and BMI z-score. Random-effects logistic regression models were used to determine the relationship of the dietary variables with obesity status and to understand if the percent energy intake (%EI) derived from fat from all meals (breakfast, lunch, dinner, and snacks) affected obesity. Results. Older children (age 4-19 years) consumed a higher percent of energy at lunch and dinner and less percent energy from snacks compared to younger children. Age was significantly associated with percentage of total energy intake (%TEI) for lunch, as well as dinner, while no association was found by gender. Percent of energy consumed from dinner significantly differed by obesity status, with obese children consuming more energy at dinner (p = 0.03), but no associations were found between percent energy from fat and obesity across all meals. Conclusions. Information from this study can be used to develop interventions that target dietary intake patterns in obesity prevention programs for Hispanic children and adolescents. In particular, intervention programs for children should target dietary patterns with energy intake that is spread throughout the day and earlier in the day. These results indicate that a longitudinal study should be used to further explore the relationship of dietary patterns and BMI in this and other populations (Dubois et al., 2008; Rodriquez & Moreno, 2006; Thompson et al., 2005; Wilson et al., in review, 2008). ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent data have shown that the percentage of time spent preparing food has decreased during the past few years, and little information is know about how much time people spend grocery shopping. Food that is pre-prepared is often higher in calories and fat compared to foods prepared at home from scratch. It has been suggested that, because of the higher energy and total fat levels, increased consumption of pre-prepared foods compared to home-cooked meals can lead to weight gain, which in turn can lead to obesity. Nevertheless, to date no study has examined this relationship. The purpose of this study is to determine (i) the association between adult body mass index (BMI) and the time spent preparing meals, and (ii) the association between adult BMI and time spent shopping for food. Data on food habits and body size were collected with a self-report survey of ethnically diverse adults between the ages of 17 and 70 at a large university. The survey was used to recruit people to participate in nutrition or appetite studies. Among other data, the survey collected demographic data (gender, race/ethnicity), minutes per week spent in preparing meals and minutes per week spent grocery shopping. Height and weight were self-reported and used to calculate BMI. The study population consisted of 689 subjects, of which 276 were male and 413 were female. The mean age was 23.5 years, with a median age of 21 years. The fraction of subjects with BMI less than 24.9 was 65%, between 25 and 29.9 was 26%, and 30 or greater was 9%. Analysis of variation was used to examine associations between food preparation time and BMI. ^ The results of the study showed that there were no significant statistical association between adult healthy weight, overweight and obesity with either food preparation time and grocery shopping time. Of those in the sample who reported preparing food, the mean food preparation time per week for the healthy weight, overweight, and obese groups were 12.8 minutes, 12.3 minutes, and 11.6 minutes respectively. Similarly, the mean weekly grocery shopping for healthy, overweight, and obese groups were 60.3 minutes per week (8.6min./day), 61.4 minutes (8.8min./day), and 57.3 minutes (8.2min./day), respectively. Since this study was conducted through a University campus, it is assumed that most of the sample was students, and a percentage might have been utilizing meal plans on campus, and thus, would have reported little meal preparation or grocery shopping time. Further research should examine the relationships between meal preparation time and time spent shopping for food in a sample that is more representative of the general public. In addition, most people spent very little time preparing food, and thus, health promotion programs for this population need to focus on strategies for preparing quick meals or eating in restaurants/cafeterias. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Colorectal cancer (CRC) has been one of the leading causes of cancer death in the United States. Although incidence and mortality rates of colorectal cancer in the United States have decreased in recent years, the disparity in CRC incidence and mortality between African Americans and Whites remain. Disparity in CRC screening rates is believed to be one of the causes that contribute to the disparity in CRC incidence and mortality between these two races. Finding the differences in CRC screening barriers and predictors between these two groups can help us to design more effective intervention programs to improve CRC screening rates for African Americans. However, most of the previous studies have investigated different types of CRC screening barriers for African Americans and/or Whites, but no studies have compared the same CRC screening barriers between African Americans and Whites. The purpose of this study is to describe and compare the same CRC screening barriers between these two races. Using chi-square analysis, significant differences between African Americans and Whites were found for marital status, income and education. Compared to Whites, African Americans were less aware of CRC screening procedures and lacked CRC knowledge. Significant differences were found between African Americans and Whites in the awareness of sigmoidoscopy, colonoscopy and barium enema. After adjusting for sex, education, marital status, and household income, six out of thirteen CRC screening barriers and two out of nine CRC screening predictors remained to be statistically significantly different between African Americans and Whites. The results of this study indicated that different CRC screening barriers and predictors had different impact on African Americans, and African Americans had more CRC barriers to overcome than Whites.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The underlying genetic defects of a congenital disease Nail-Patella Syndrome are loss-of-function mutations in the LMX1B gene. Lmx1b encodes a LIM-homeodomain transcription factor that is expressed specifically in the dorsal limb bud mesenchyme. Gain- and loss-of-function experiments suggest that Lmx1b is both necessary and sufficient to specify dorsal limb patterning. However, how Lmx1b coordinates patterning of the dorsal tissues in the limb, including muscle, skeleton and connective tissues, remains unknown. One possibility is that each tissue specifies its own pattern cell-autonomously, i.e., Lmx1b is expressed in tissues in which it functions and different tissues do not communicate with each other. Another possibility is that tissues that express Lmx1b interact with adjacent tissues and provide patterning information thereby directing the development of tissues non-cell-autonomously. Previous results showed that Lmx1b is expressed in limb connective tissue and skeleton, but is not expressed in muscle tissue. Moreover, muscles and muscle connective tissue are closely associated during development. Therefore, we hypothesize that Lmx1b controls limb muscle dorsal-ventral (DV) patterning through muscle connective tissue, but regulates skeleton and tendon/ligament development cell-autonomously. ^ To test this hypothesis, we first examined when and where the limb dorsal-ventral asymmetry is established during development. Subsequently, conditional knockout and overexpression experiments were performed to delete or activate Lmx1b in different tissues within the limb. Our results show that deletion of Lmx1b from whole limb mesenchyme results in all dorsal tissues, including muscle, tendon/ligament and skeleton, transforming into ventral structures. Skeleton-specific knockout of Lmx1b led to the dorsal duplication of distal sesamoid and metacarpal bones, but did not affect the pattern formation of other tissues, suggesting that Lmx1b controls skeleton development cell-autonomously. In addition, this skeleton-specific pattern alteration only occurs in distal limb tissues, not proximal limb tissues, indicating different regulatory mechanisms operate along the limb proximal-distal axis. Moreover, skeleton-specific ectopic expression of Lmx1b reveals a complementary skeletal-specific dorsalized phenotype. This result supports a cell-autonomous role for Lmx1b in dorsal-ventral skeletal patterning. This study enriched our understanding of limb development, and the insights from this research may also be applicable for the development of other organs. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Previous research has shown an association between mental health status and cigarette smoking. This study examined four specific mental health predictors and the outcome variable any smoking, defined as smoking one or more cigarettes in the past 30 days. The population included active duty military members serving in the United States Army, Air Force, Navy and Marine Corps. The data was collected during the 2005 Department of Defense Survey of Health Related Behaviors Among Active Duty Military Personnel, a component of the Defense Lifestyle Assessment Program. The sample size included 13,603 subjects. This cross sectional prevalence study consisted of descriptive statistics, univariate analysis, and multivariate logistic regression analysis of the four mental health predictors and the any smoking outcome variable. Multivariate adjustment showed an association between the four mental health predictors and any smoking. This association is consistent with previous literature and can help guide public health officials in the development of smoking prevention and cessation programs.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Health disparities have been documented for the United States mainland. No literature was found comparing the mainland population to that of Puerto Rico, Guam, and the United States Virgin Islands (United States territories). Using Healthy Lifestyle Characteristics of non-smoking, maintaining a healthy weight, consuming fruits/vegetables daily, and exercising regularly, the health of the mainland was compared to United States territories. The research questions were: (1) Among the characteristics, what are similarities/differences between citizens of the mainland United States and territories?, (2) Among the characteristics, what are similarities/differences in how the territories compare to each other?, (3) Does the mainland and the territories meet Healthy People 2010 goals for these characteristics?, (4) Are perceptions of health concordant or discordant with the characteristics for mainlanders and Puerto Ricans? ^ Using 2007 data from Behavioral Risk Factor Surveillance System (BRFSS), frequency distributions were compared for the Healthy Lifestyle Characteristics for the mainland territories. Research found smoking rates on Guam were statistically greater than the mainland, Puerto Rico or the Virgin Islands. Healthy body mass index levels and physical activity rates were better on Guam compared to other locations. Puerto Rico had significantly more overweight and obese persons, lower fruit/vegetable consumption rates, and lower physical activity rates than the mainland, Guam and the Virgin Islands. Research found mainlanders reported statistically greater participation in regular physical activity than did Puerto Ricans and Virgin Islanders; there were significant differences in fruit/vegetable consumption rates compared to both. The research found no locations met all four of Healthy People 2010 goals. Compared to mainlanders, research showed Puerto Ricans perceive their health significantly worse.^ A better understanding is needed for how United States citizens (mainlanders and territory residents) view participation in healthy behaviors and how health is affected by participating or not in healthy behaviors. For the year examined, Healthy People 2010 goals were not achieved. This study demonstrates Puerto Ricans’ health, using the four characteristics, is significantly worse than residents in the other locations. Public health programs targeting Puerto Ricans are warranted. Finally, this study highlights the need for continued research on the relationships among the mainland and territories.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: With over 440 million cases of infections worldwide, genital HPV is the most frequent sexually transmitted infection. There are several types including high risk types 16, 18, 58 and 70 among others, which are known to cause cervical cell abnormality and if persistent, can lead to cervical cancer which globally, claims 288,000 lives annually. 33.4 million people worldwide are currently living with HIV/AIDS, with 22.4 million in sub-Saharan Africa where 70% of the female population living with HIV/AIDS is also found. Similar risk factors for HPV, cervical cancer and HIV/AIDS include early age at sexual debut, multiple sexual partners, infrequent condom use, history of STI and immune-suppression. ^ Objectives: To describe the role of HPV in cervical cancer development, to describe the influence of HIV/AIDS on HPV and in the development of cervical cancer and to describe the importance of preventive measures such as screening. ^ Methods: This is a literature review where data were analyzed qualitatively and a descriptive narrative style used to evaluate and present the information. The data came from searches using Pub Med, Cochrane Library, EBSCO Medline databases as well as websites such as the CDC and WHO. Articles selected were published in English over the last 10 years. Keywords used included: 'HPV, cervical cancer and HIV', 'HIV and HPV', 'HPV and cervical cancer', 'HPV infection', 'HPV vaccine', 'genital HPV', 'HIV and cervical cancer', 'prevalence of HIV and cervical cancer' and 'prevalence of cervical cancer'. ^ Results: Women with HIV/AIDS have multiple HPV types, persistent infection, are more likely to present with cervical neoplasia and are at higher risk for cervical cancer. Research also shows that HIV could affect the transmissibility of HPV and that HPV itself could also increase the susceptibility to HIV acquisition. ^ Conclusion: HIV, genital HPV and cervical cancer are all preventable. Need to emphasize programs that aim to increase HIV/AIDS, HPV and cervical cancer awareness. Stress importance of behavior modification such as frequent use of condoms, decreased sexual partners and delayed first intercourse. Facilitate programs for screening and treating HPV, male circumcision, effective management of HAART and HPV vaccination.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Multiple dietary deficiencies and high rates of infectious illness are major health problems leading to malnutrition and limitation of growth of children in developing countries. Longitudinal studies which provide information on illness incidence and growth velocity are needed in order to untangle the complex interrelationship between nutrition, illness and growth. From 1967 to 1973, researchers led by Dr. Bacon Chow of the Johns Hopkins University School of Hygiene undertook a quasi-experimental prospective study in Suilin Township, Taiwan to determine the effects of a nutritional supplement to the diets of pregnant and lactating women on the growth, development and resistance to disease of their offspring. This dissertation presents results from the analysis of infant morbidity and postnatal growth.^ Maternal nutritional supplementation has no apparent effect on the postnatal growth or morbidity of infants. Significant sex differences exist in growth response to illness and in illness susceptibility. Male infants have more diarrhea and upper respiratory illness. Respiratory illness is positively associated with growth rate in weight in the first semester of life. Diarrhea is significantly negatively associated with growth in length in the second semester. Small-for-date infants are more susceptible to illness in general and have a different pattern of growth response than large-for-date infants.^ Principal components analysis of illness data is shown to be an effective technique for making more precise use of ambiguous morbidity data. Multiple regression with component scores is an accurate method for estimating variance in growth rate predicted by indepenent illness variables. A model is advanced in which initial postnatal growth rate determines subsequent susceptibility to nutritional stress and infection. Initial growth rate is a function of prenatal nutrition, but is not significantly affected by maternal supplementation during gestation or lactation. Critical evaluation is made of nutritional supplementation programs which do not afford disease control.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cardiovascular disease (CVD) is highly preventable, yet it is a leading cause of death among women in Texas. The primary goals of this research were to examine past and current trends of CVD, as well as identify whether there is an association between the insurance coverage and mortality from CVD among women aged 60–65 in Texas between 2000 and 2011. ^ The systematic review of the research is based on the guidelines and recommendations set by the Centre for Reviews and Dissemination for conducting reviews in health care. Over 47 citations of peer-reviewed articles from Ovid MEDLINE and PubMed databases and five websites were identified, of which 7 studies met inclusion criteria for the first systematic review to examine the trends of CVD in Texas. Ten citations of peer-reviewed articles from Ovid MEDLINE and PubMed databases and five web sites were reviewed for the second systematic review (to study the association between insurance coverage and cardiovascular health among Texas women 60–64 years of age), of which 3 studies met inclusion criteria and were included in the research. The results of the study highlighted key gaps in the existing literature and important areas for the further research, as well as determined directions for future public health CVD prevention programs in Texas. ^ Based on the conducted research, the major determinants of premature mortality among women attributed to cardiovascular disease are based on individual level characteristics, more specifically sex, age, race/ethnicity, and education. The results indicate that African American and non-Hispanic white women are more likely to have higher CVD mortality rates than Hispanic women due to higher prevalence of cardiac risk factors. The data also shows higher levels of mortality from CVD in the southeastern United States, with Texas ranking as the third state with the highest prevalence of CVD among women. According to the Texas Department of State Health Services, there are approximately 56,000 deaths caused by CVD annually in Texas, which represents about one death every ten minutes. Coronary artery disease and stroke were the causes of 31.2 percent of all female deaths in Texas in 2009, meaning that approximately 68 women die from any form of cardiac disease in Texas each day. ^ The data of the reviewed studies indicate that women' lack of health insurance was significantly associated with a higher prevalence of cardiovascular disease. The uninsured women were more likely to be unaware of their risk factors and more likely to have undiagnosed diabetes—a co-morbidity factor of CVD. One of the studies also reports strong correlation between state rates of uninsured and lower rates of preventive care. Given these strong correlations, those who were chronically uninsured were at a higher risk of mortality than the insured, due to prolonged periods of time without basic access to preventive and medical care. ^ Suggested recommendations to decrease CVD mortality rates in Texas are consistent with the existing literature and include state policy development that addresses elimination of health disparities, consideration of potential benefits of universal health coverage by the legislative policymakers, and maintenance of solid partnerships between public health agencies and hospitals to educate on, diagnose, and treat CVD among the female population in Texas. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objectives. This study estimated the prevalence of risky sexual behaviors of older (≥ years old) and younger (18-24 years) men who have sex with men (MSM) in Houston, TX and compared the prevalence of these behaviors between the two age cohorts. ^ Methods. Data used in this analysis were from the third MSM cycle of the National HIV Behavioral Surveillance Study. There were 80 older and 119 younger MSM who met the eligibility criteria. Bivariate and Multivariate analysis were performed to compare risky sexual behaviors from the past 12 months and at last sexual encounter between the two age cohorts. ^ Results. OMSM were more likely to be Non-Hispanic White (AOR=4.17; CI: 1.46, 11.89), to have a household income last year greater than $75,000 (AOR=3.59; CI: 1.12, 11.55), and to self-report HIV-positive (AOR=7.35; CI: 2.69, 20.10) than YMSM. OMSM were less like to have had anal sex (AOR=0.11; CI: 0.04, 0.29) or a main sex partner (AOR=0.2; CI: 0.09, 0.45) than YMSM in the past 12 months. Among MSM who had anal sex at last sexual encounter, OMSM were more likely to have not used a condom the entire time regardless of partner type (AOR=3.64; CI: 1.54, 8.61), not used a condom the entire time with a causal sex partner (AOR=7.72; CI: 1.76, 33.92), had unprotected insertive anal intercourse (AOR=2.92; CI: 1.1, 7.75), and used alcohol before or during sex (AOR=5.33; CI: 2.15, 13.2) than YMSM. YMSM and OMSM did not different significantly in knowledge of last sex partner's HIV status. ^ Conclusions. This is not a homogeneous sample of OMSM and risky sexual behaviors vary within the group. There were many similarities in risk behavior between OMSM and YMSM but also some key differences in partner type and condom use indicating a need for increased age-appropriate health promotion programs to limit a potential increase in HIV infection among OMSM. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Hispanics form the second-largest minority group in the United States totaling 22 million people. Health data on this population are sparse and inconsistent. This study seeks to determine use of preventative services and risk factor behaviors of Mexican American and non-Hispanic White females residing in South Texas.^ Baseline data from female respondents in household surveys in six South Texas counties (Ramirez and McAlister, 1988; McAlister et al., 1992) were analyzed to test the following hypotheses: (1) Mexican American and Non-Hispanic White females exhibit different patterns of health behaviors; (2) Mexican American females will exhibit different health behaviors regardless of age; and (3) the differences between Mexican American women and non-Hispanic White females are due to education and acculturation factors.^ Over the past decade, the traditional behaviors of Mexican American females have begun to change due to education, acculturation, and their participation in the labor force. The results from this study identify some of the changes that will require immediate attention from health care providers. Results revealed that regardless of ethnicity, age, education, and language preference, non-Hispanic White females were significantly more likely to participate in preventive screening practices than were Mexican American females. Risk factor analysis revealed a different pattern with Mexican American females significantly more likely to be non-smokers, non-alcoholic drinkers, and to have good fat avoidance practices compared to non-Hispanic White females. However, compared to those who are less-educated or Spanish-speaking, Mexican American females with higher levels of education and preference for speaking English only showed positive and negative health behaviors that were more similar to the non-Hispanic White females. The positive health behaviors that come with acculturation, e.g., more participation in preventive care and more physical activity, are welcome changes. But this study has implications for global health development and reinforces a need for "primordial" prevention strategies to deter the unwanted concomitants of economic development and acculturation. Smoking and drinking behaviors among Mexican American females need to be kept at low levels to prevent increased morbidity and premature deaths in this population. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This cross-sectional study examines the association between health and academic achievement among Hispanic eighth-grade students in the Houston Independent School District. As part of the district's 3 year Safe Schools/Healthy Students Initiative to enhance comprehensive educational programs, a brief anonymous questionnaire was administered in the classroom to 359 students in two schools during a one-month period in the early part of the 2001 school year. ^ The primary study questions are: Among this sample of Hispanic adolescents, is there a significant association between academic achievement and health status? and in this same population, is there a significant association between health risk behavior and health status? The specific aims of this research are: (1) to describe the association between academic achievement and health status; (2) to describe the association between health risk behaviors and health status; and (3) to describe the relative contribution of health risk behaviors and academic achievement to adolescent health status among this sample of Hispanic adolescents. ^ The survey instrument was a 32-item questionnaire that incorporated: several academic achievement questions measuring usual grades, school-related performance, attendance, student and perceived parental satisfaction with academic achievement, and educational aspirations; two health and quality of life scales measuring adolescent self-reported health; and specific measures of health risk behavior, e.g., frequency of tobacco cigarette smoking, alcohol and other drug use, aggression, and suicidal ideation and behavior that were incorporated from the national Youth Risk Behavior Survey. Questions pertaining to sexual behavior and pregnancy were omitted to comply with school district guidelines. ^ Analysis revealed that strong associations between academic achievement and health status and between health risk behaviors and health status were observed after controlling for the covariates. Eight factors were found to be significantly associated with poor health status: usual grades (low), academic performance (low), academic achievement beliefs (low), classroom and homework performance satisfaction (low), ever drinking alcohol (6 or more times), suicidality (ever thought about, planned for, or sought medical help after attempting suicide), gender (female), and age (15 years and older). (Abstract shortened by UMI.) ^