35 resultados para Sequence-analysis


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Enterococcus faecium recently evolved from a generally avirulent commensal into a multidrug-resistant health care-associated pathogen causing difficult-to-treat infections, but little is known about the factors responsible for this change. We previously showed that some E. faecium strains express a cell wall-anchored collagen adhesin, Acm. Here we analyzed 90 E. faecium isolates (99% acm(+)) and found that the Acm protein was detected predominantly in clinically derived isolates, while the acm gene was present as a transposon-interrupted pseudogene in 12 of 47 isolates of nonclinical origin. A highly significant association between clinical (versus fecal or food) origin and collagen adherence (P

Relevância:

60.00% 60.00%

Publicador:

Resumo:

PURPOSE: The present study defines genomic loci underlying coordinate changes in gene expression following retinal injury. METHODS: A group of acute phase genes expressed in diverse nervous system tissues was defined by combining microarray results from injury studies from rat retina, brain, and spinal cord. Genomic loci regulating the brain expression of acute phase genes were identified using a panel of BXD recombinant inbred (RI) mouse strains. Candidate upstream regulators within a locus were defined using single nucleotide polymorphism databases and promoter motif databases. RESULTS: The acute phase response of rat retina, brain, and spinal cord was dominated by transcription factors. Three genomic loci control transcript expression of acute phase genes in brains of BXD RI mouse strains. One locus was identified on chromosome 12 and was highly correlated with the expression of classic acute phase genes. Within the locus we identified the inhibitor of DNA binding 2 (Id2) as a candidate upstream regulator. Id2 was upregulated as an acute phase transcript in injury models of rat retina, brain, and spinal cord. CONCLUSIONS: We defined a group of transcriptional changes associated with the retinal acute injury response. Using genetic linkage analysis of natural transcript variation, we identified regulatory loci and candidate regulators that control transcript levels of acute phase genes.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Inactivation by allelic exchange in clinical isolates of the emerging nosocomial pathogen Enterococcus faecium has been hindered by lack of efficient tools, and, in this study, transformation of clinical isolates was found to be particularly problematic. For this reason, a vector for allelic replacement (pTEX5500ts) was constructed that includes (i) the pWV01-based gram-positive repAts replication region, which is known to confer a high degree of temperature intolerance, (ii) Escherichia coli oriR from pUC18, (iii) two extended multiple-cloning sites located upstream and downstream of one of the marker genes for efficient cloning of flanking regions for double-crossover mutagenesis, (iv) transcriptional terminator sites to terminate undesired readthrough, and (v) a synthetic extended promoter region containing the cat gene for allelic exchange and a high-level gentamicin resistance gene, aph(2'')-Id, to distinguish double-crossover recombination, both of which are functional in gram-positive and gram-negative backgrounds. To demonstrate the functionality of this vector, the vector was used to construct an acm (encoding an adhesin to collagen from E. faecium) deletion mutant of a poorly transformable multidrug-resistant E. faecium endocarditis isolate, TX0082. The acm-deleted strain, TX6051 (TX0082Deltaacm), was shown to lack Acm on its surface, which resulted in the abolishment of the collagen adherence phenotype observed in TX0082. A mobilizable derivative (pTEX5501ts) that contains oriT of Tn916 to facilitate conjugative transfer from the transformable E. faecalis strain JH2Sm::Tn916 to E. faecium was also constructed. Using this vector, the acm gene of a nonelectroporable E. faecium wound isolate was successfully interrupted. Thus, pTEX5500ts and its mobilizable derivative demonstrated their roles as important tools by helping to create the first reported allelic replacement in E. faecium; the constructed this acm deletion mutant will be useful for assessing the role of acm in E. faecium pathogenesis using animal models.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Pili in Gram-positive bacteria play a major role in the colonization of host tissue and in the development of biofilms. They are promising candidates for vaccines or drug targets since they are highly immunogenic and share common structural and functional features among various Gram-positive pathogens. Numerous publications have helped build a detailed understanding of pilus surface assembly, yet regulation of pilin gene expression has not been well defined. Utilizing a monoclonal antibody developed against the Enterococcus faecalis major pilus protein EbpC, we identified mutants from a transposon (Tn) insertion library which lack surface-exposed Ebp pili. In addition to insertions in the ebp regulon, an insertion in ef1184 (dapA) significantly reduced levels of EbpC. Analysis of in-frame dapA deletion mutants and mutants with the downstream gene rnjB deleted further demonstrated that rnjB was responsible for the deficiency of EbpC. Sequence analysis revealed that rnjB encodes a putative RNase J2. Subsequent quantitative real-time PCR (qRT-PCR) and Northern blotting demonstrated that the ebpABC mRNA transcript level was significantly decreased in the rnjB deletion mutant. In addition, using a reporter gene assay, we confirmed that rnjB affects the expression of the ebpABC operon. Functionally, the rnjB deletion mutant was attenuated in its ability to produce biofilm, similar to that of an ebpABC deletion mutant which lacks Ebp pili. Together, these results demonstrate the involvement of rnjB in E. faecalis pilin gene expression and provide insight into a novel mechanism of regulation of pilus production in Gram-positive pathogens.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Linezolid, which targets the ribosome, is a new synthetic antibiotic that is used for treatment of infections caused by Gram-positive pathogens. Clinical resistance to linezolid, so far, has been developing only slowly and has involved exclusively target site mutations. We have discovered that linezolid resistance in a methicillin-resistant Staphylococcus aureus hospital strain from Colombia is determined by the presence of the cfr gene whose product, Cfr methyltransferase, modifies adenosine at position 2503 in 23S rRNA in the large ribosomal subunit. The molecular model of the linezolid-ribosome complex reveals localization of A2503 within the drug binding site. The natural function of cfr likely involves protection against natural antibiotics whose site of action overlaps that of linezolid. In the chromosome of the clinical strain, cfr is linked to ermB, a gene responsible for dimethylation of A2058 in 23S rRNA. Coexpression of these two genes confers resistance to all the clinically relevant antibiotics that target the large ribosomal subunit. The association of the ermB/cfr operon with transposon and plasmid genetic elements indicates its possible mobile nature. This is the first example of clinical resistance to the synthetic drug linezolid which involves a natural resistance gene with the capability of disseminating among Gram-positive pathogenic strains.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND: A 24-year-old man presented with previously diagnosed Marfan's syndrome. Since the age of 9 years, he had undergone eight cardiovascular procedures to treat rapidly progressive aneurysms, dissection and tortuous vascular disease involving the aortic root and arch, the thoracoabdominal aorta, and brachiocephalic, vertebral, internal thoracic and superior mesenteric arteries. Throughout this extensive series of cardiovascular surgical repairs, he recovered without stroke, paraplegia or renal impairment. INVESTIGATIONS: CT scans, arteriogram, genetic mutation screening of transforming growth factor beta receptors 1 and 2. DIAGNOSIS: Diffuse and rapidly progressing vascular disease in a patient who met the diagnostic criteria for Marfan's syndrome, but was later rediagnosed with Loeys-Dietz syndrome. Genetic testing also revealed a de novo mutation in transforming growth factor beta receptor 2. MANAGEMENT: Regular cardiovascular surveillance for aneurysms and dissections, and aggressive surgical treatment of vascular disease.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The shuttle vector plasmid pZ189 was used to find the kinds of mutations that are induced by herpes simplex virus type-1 (HSV-1). In cells infected by HSV-1 the frequency of mutation in supF gene, the mutagenesis marker, was increased over background by from two- to seven-fold, reaching 0.14-0.45%. No increase was induced by infection by vaccinia virus under the same conditions. Mutagenesis was an early event, showing a four-fold increase in mutation frequency at only two hours after infection, and peaking at a seven-fold increase at four hours after infection. DNA sequencing and gel electrophoresis analysis were performed on 105 HSV-1 induced mutants and 65 spontaneous mutants and provided the following information: (1) A change in plasmid size was seen in 54% of HSV-1 related mutants, compared with only 37% of spontaneous mutants. (2) Among point mutations, the predominant type was G:C to A:T transition, which accounted for 51% of point mutations in mutants isolated from cells infected with HSV-1, and 32% of point mutations in spontaneous mutants. (3) Deletions of DNA were seen in HSV-1 related mutants at a frequency of 40%, compared with 29% in spontaneous mutants. The HSV-1 related deletions were about half the length of spontaneous mutants and three contained short filler sequences. (4) Fifteen (15%) of HSV-1 induced mutants revealed the altered restriction patterns on agarose gel electrophoresis analysis and were due either to rearrangements of plasmid DNA, and/or to insertion of sequences derived from chromosomal DNA (seven plasmids). No insertions of DNA from HSV-1 were detected. Among spontaneous mutants, only 5 (7.7%) were rearrangements and none had inserted chromosomal DNA. (5) DNA sequence analysis of seven plasmids with inserted chromosomal DNA revealed that four cases had repetitive DNA sequences integrated and the other three were unidentified sequences from the GenBank database. Three repetitive DNA included $\alpha$ satellite, Alu and KpnI family sequences. The other sequence was identified as tRNA-like component. The observed mutations have implications for the mechanism of malignant transformation of cells by HSV-1. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Aniridia (AN) is a congenital, panocular disorder of the eye characterized by the complete or partial absence of the iris. The disease can occur in both the sporadic and familial forms which, in the latter case, is inherited as an autosomal dominant trait with high penetrance. The objective of this study was to isolate and characterize the genes involved in AN and Sey, and thereby to gain a better understanding of the molecular basis of the two disorders.^ Using a positional cloning strategy, I have approached and cloned from the AN locus in human chromosomal band 11p13 a cDNA that is deleted in two patients with AN. The deletions in these patients overlap by about 70 kb and encompass the 3$\sp\prime$ end of the cDNA. This cDNA detects a 2.7 kb mRNA encoded by a transcription unit estimated to span approximately 50 kb of genomic DNA. The message is specifically expressed in all tissues affected in all forms of AN, namely within the presumptive iris, lens, neuroretina, the superficial layers of the cornea, the olfactory bulbs, and the cerebellum. Sequence analysis of the AN cDNA revealed a number of motifs characteristic of certain transcription factors. Chief among these are the presence of the paired domain, the homeodomain, and a carboxy-terminal domain rich in serine, threonine and proline residues. The overall structure shows high homology to the Drosophila segmentation gene paired and members of the murine Pax family of developmental control genes.^ Utilizing a conserved human genomic DNA sequence as probe, I was able to isolate an embryonic murine cDNA which is over 92% homologous in nucleotide sequence and virtually identical at the amino acid level to the human AN cDNA. The expression pattern of the murine gene is the same as that in man, supporting the conclusion that it probably corresponds to the Sey gene. Its specific expression in the neuroectodermal component of the eye, in glioblastomas, but not in the neural crest-derived PC12 pheochromocytoma cell line, suggests that a defect in neuroectodermal rather mesodermal development might be the common etiological factor underlying AN and Sey. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Expression of the differentiated skeletal muscle phenotype is a process that appears to occur in at least two stages. First, pluripotent stem cells become committed to the myogenic lineage. Although undifferentiated and capable of continued proliferation, determined myoblasts are restricted to a single developmental fate. Upon receiving the appropriate environmental signals, these determined myoblasts withdraw from the cell cycle, fuse to form multi-nucleated myotubes, and begin to express a battery of muscle-specific gene products that make up the functional and contractile apparatus of the muscle. This project is aimed at the identification and characterization of factors that control the determination and differentiation of myogenic cells. We have cloned a cDNA, called myogenin, that plays an important role in these processes. Myogenin is expressed exclusively in skeletal muscle in vivo and myogenic cell lines in vitro. Its expression is sharply upregulated during differentiation. When constitutively expressed in fibroblasts, myogenin converts these cells to the myogenic lineage. Transfected cells behave as myogenic tissue culture cells with respect to the genes they express, the way they respond to environmental cues, and are capable of fusing to form multinucleated myotubes. Sequence analysis showed that this cDNA has homology to a family of transcription factors in a region of 72 amino acids known as the basic helix-loop-helix motif. This domain appears to mediate binding to a DNA sequence element known as an E-box (CANNTG) essential for the activity of the enhancers of many muscle-specific genes.^ Analysis of myogenin in tissue culture cells showed that its expression is responsive to many of the environmental cues, such as the presence of growth factors and oncogenes, that modulate myogenesis. In an attempt to identify the cis- and trans-elements that control myogenin expression and thereby understand what factors are responsible for the establishment of the myogenic lineage, we have cloned the myogenin gene. After analysis of the gene structure, we constructed a series of reporter constructs from the 5$\prime$ upstream sequence of the myogenin gene to determine which cis-acting sequences might be important in myogenin regulation. We found that 184 nucleotides of the 5$\prime$ sequence was sufficient to direct high-level muscle-specific expression of the reporter gene. Two sequence elements present in the 184 fragment, an E-box and a MEF-2 site, have been shown previously to be important in muscle-specific transcription. Mutagenesis of these sites revealed that both sites are necessary for full activity of the myogenin promoter, and suggests that a complex hierarchy of transcription factors control myogenic differentiation. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Transglutaminases are a family of calcium-dependent enzymes, that catalyze the covalent cross-linking of proteins by forming $\varepsilon(\gamma$-glutamyl)lysine isopeptide bonds. In order to investigate the molecular mechanisms regulating the expression of the tissue transglutaminase gene and to determine its biological functions, the goal of this research has been to clone and characterize the human tissue transglutaminase promoter. Thirteen clones of the tissue transglutaminase gene were obtained from the screening of a human placental genomic DNA library. A 1.74 Kb fragment derived from DNA located immediately upstream of the translation start site was subcloned and sequenced. Sequence analysis of this DNA fragment revealed that it contains a TATA box (TATAA), a CAAT box (GGACAAT), and a series of potential transcription factor binding sites and hormone response elements. Four regions of significant homology, a GC-rich region, a TG-rich region, an AG-rich region, and HR1, were identified by aligning 1.8 Kb of DNA flanking the human, mouse, and guinea pig tissue transglutaminase genes.^ To measure promoter activity, we subcloned the 1.74 Kb fragment of the tissue transglutaminase gene into a luciferase reporter vector to generate transglutaminase promoter/luciferase reporter constructs. Transfection experiments showed that this DNA segment includes a functional promoter with high constitutive activity. Deletion analysis revealed that the SP1 sites or corresponding sequences contribute to this activity. We investigated the role of DNA methylation in regulating the activity of the promoter and found that in vitro methylation of tissue transglutaminase promoter/luciferase reporter constructs suppressed their basal activity. Methylation of the promoter is inversely correlated with the expression of the tissue transglutaminase gene in vivo. These results suggest that DNA methylation may be one of the mechanisms regulating the expression of the gene. The tumor suppressor gene product p53 was also shown to inhibit the activity of the promoter, suggesting that induction of the tissue transglutaminase gene is not involved in the p53-dependent programmed cell death pathway. Although retinoids regulate the expression of the tissue transglutaminase gene in vivo, retinoid-inducible activity can not be identified in 3.7 Kb of DNA 5$\sp\prime$ to the tissue transglutaminase gene.^ The structure of the 5$\sp\prime$ end of the tissue transglutaminase gene was mapped. Alignment analysis of the human tissue transglutaminase gene with other human transglutaminases showed that tissue transglutaminase is the simplest member of transglutaminase superfamily. Transglutaminase genes show a conserved core of exons and introns but diverse N-terminuses and promoters. These observations suggest that key regulatory sequences and promoter elements have been appended upstream of the core transglutaminase gene to generate the diversity of regulated expression and regulated activity characteristic of the transglutaminase gene family. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Enterococci are one of the leading causes of nosocomial infections, and Enterococcus faecalis causes the majority of enterococcal infections. However, the mechanisms of enterococcal pathogenesis are still not yet understood. In our initial screening of E. faecalis strain OG1RF genomic libraries, autolysin and a homolog of a protein of Enterococcus faecium previously designated P54 were found to be two major antigens that reacted with human patient sera, and an antigen designated MH-1 antigen that reacted with serum from a endocarditis patient was also identified. To explore a possible role for these antigens in enterococcal infections, the genes encoding these three antigens were disrupted in Enterococcus faecalis OG1RF. ^ To explore a possible role of an E. faecalis gelatinase (encoded by gelE), which belongs to a family of Zn-metalloproteases that have been shown to be virulence factors in other organisms, in enterococcal infections, an insertion mutant was constructed in OG1RF and tested in the mouse peritonitis model. The mice infected with the gelE mutant showed a significantly prolonged survival compared to the wild type strain. To study the expression of gelE, the regions flanking gelE were sequenced. Sequence analysis of the gelE flanking regions revealed three genes (fsrA, fsrB and fsrC) upstream of gelE that show homology to the genes in a locus (agr) that globally regulates the expression of virulence factors in Staphylococcus aureus and one open reading frame (sprE) with homology to bacterial serine protease downstream of gelE. ^ In conclusion, in this study of identification of possible virulence factors in E. faecalis surface and secreted proteins, of three genes encoding antigens detected by human patient sera, none could be shown to effect virulence in the mouse peritonitis model. Inactivation of one of these antigens (autolysin) was shown to slightly increase the tolerance of E. faecalis to penicillin. A serine protease and a locus (fsr) that regulates the expression of gelE and sprE were shown to be important for enterococcal infection in the mouse peritonitis model. (Abstract shortened by UMI.)^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Insulin-like growth factor binding protein 2 (IGFBP2) is a protein known to be overexpressed in a majority of glioblastoma multiforme (GBM) tumors. While it is known the IGFBP2 is involved in promoting GBM tumor cell invasion, no mechanism exists for how the protein is involved in signal transduction pathways leading to enhanced cell invasion. ^ We follow up on preliminary microarray data on IGFBP2-overexpressing GBM cells and protein sequence analysis of IGFBP2 in generating the hypothesis that IGFBP2 interacts with integnn α5 in regulating cell mobility. Microarray data showing upregulation of integrin α5 by IGFBP2 is validated and evidence of protein-protein interaction between IGFBP2 and integrin α5 is found. The exact binding domain on IGFBP2 responsible for its interaction with integrin α5 is also determined, confirming our initial findings and reaffirming that the IGFBP2/integrin α5 interaction is specific. Disruption of this interaction resulted in attenuation of IGFBP2-enhanced cell mobility. Further, we found that cell mobility is only enhanced when IGFBP2 and integrin α5 are both overexpressed and able to interact with each other. ^ We also determined fibronectin to be a critical player in the activation of the IGFBP2/integrin α5 pathway. The activation of this pathway appears to be progressive and initiates once GBM cells have sufficiently established anchorage. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The basis for the recent transition of Enterococcus faecium from a primarily commensal organism to one of the leading causes of hospital-acquired infections in the United States is not yet understood. To address this, the first part of my project assessed isolates from early outbreaks in the USA and South America using sequence analysis, colony hybridizations, and minimal inhibitory concentrations (MICs) which showed clinical isolates possess virulence and antibiotic resistance determinants that are less abundant or lacking in community isolates. I also revealed that the level of ampicillin resistance increased over time in clinical strains. By sequencing the pbp5 gene, I demonstrated an ~5% difference in the pbp5 gene between strains with MICs <4ug/ml and those with MICs >4µg/ml, but no specific sequence changes correlated with increases in MICs within the latter group. A 3-10% nucleotide difference was also seen in three other genes analyzed, which suggested the existence of two distinct subpopulations of E. faecium. This led to the second part of my project analyzing concatenated core gene sequences, SNPs, the 16S rRNA, and phylogenetics of 21 E. faecium genomes confirming two distinct clades; a community-associated (CA) clade and hospital-associated (HA) clade. Molecular clock calculations indicate that these two clades likely diverged ~ 300,000 to > 1 million years ago, long before the modern antibiotic era. Genomic analysis also showed that, in addition to core genomic differences, HA E. faecium harbor specific accessory genetic elements that may confer selection advantages over CA E. faecium. The third part of my project discovered 6 E. faecium genes with the newly identified “WxL” domain. My analyses, using RT-PCR, western blots, patient sera, whole-cell ELISA, and immunogold electron microscopy, indicated that E. faecium WxL genes exist in operons, encode bacterial cell surface localized proteins, that WxL proteins are antigenic in humans, and are more exposed on the surface of clinical isolates versus community isolates (even though they are ubiquitous in both clades). ELISAs and BIAcore analyses also showed that proteins encoded by these operons bind several different host extracellular matrix proteins, as well as to each other, suggesting a novel cell-surface complex. In summary, my studies provide new insights into the evolution of E. faecium by showing that there are two distantly related clades; one being more successful in the hospital setting. My studies also identified operons encoding WxL proteins whose characteristics could also contribute to colonization and virulence within this species.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Phosphatidylserine decarboxylase of E. coli, a cytoplasmic membrane protein, catalyzes the formation of phosphatidylethanolamine, the principal phospholipid of the organism. The activity of the enzyme is dependent on a covalently bound pyruvate (Satre and Kennedy (1978) J. Biol. Chem. 253, 479-483). This study shows that the enzyme consists of two nonidentical subunits, $\alpha$ (Mr = 7,332) and $\beta$ (Mr = 28,579), with the pyruvate prosthetic group in amide linkage to the amino-terminus of the $\alpha$ subunit. Partial protein sequence and DNA sequence analysis reveal that the two subunits are derived from a proenzyme ($\pi$ subunit, Mr = 35,893) through a post-translational event. During the conversion of the proenzyme to the $\alpha$ and $\beta$ subunits, the peptide bond between Gly253-Ser254 is cleaved, and Ser254 is converted to the pyruvate prosthetic group at the amino-terminus of the $\alpha$ subunit (Li and Dowhan (1988) J. Biol. Chem. 263, 11516-11522).^ The proenzyme cannot be detected in cells carrying either single or multiple copies of the gene (psd), but can be observed in a T7 RNA polymerase/promoter and transcription-translation system. The cleavage of the wild-type proenzyme occurs rapidly with a half-time on the order of 2 min. Changing of the Ser254 to cysteine (S254C) or threonine (S254T) slows the cleavage rate dramatically and results in mutants with a half-time for processing of around 2-4 h. Change of the Ser254 to alanine (S254A) blocks the cleavage of the proenzyme. The reduced processing rate with the mutations of the proenzyme is consistent with less of the functional enzyme being made. Mutants S254C and S254T produce $\sim$15% and $\sim$1%, respectively, of the activity of the wild-type allele, but can still complement a temperature-sensitive mutant of the psd locus. Neither detectable activity nor complementation is observed by mutant S254A. These results are consistent with the hydroxyl-group of the Ser254 playing a critical role in the cleavage of the peptide bond Gly253-Ser254 of the pro-phosphatidylserine decarboxylase, and support the mechanism proposed by Snell and co-workers (Recsei and Snell (1984) Annu. Rev. Biochem. 53, 357-387) for the formation of the prosthetic group of pyruvate-dependent decarboxylases. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^