Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

The characterization of PKC-isozyme specific EGFR-dependent Erk1/2 activation in androgen-independent prostate cancer cell lines

One growth factor receptor commonly altered during prostate tumor progression is the epidermal growth factor receptor (EGFR). EGFR signaling regulates Erk1/2 phosphorylation through multiple mechanisms. We hypothesized that PKC isozymes play a role in EGFR-dependent signaling, and that through PKC isozyme selective inhibition, EGFR-dependent Erk1/2 activation can be attenuated in AICaP cells. ^ To test the hypothesis, PKC activation was induced by 12-O-tetradecanoyi-phorbol-13-acetate (TPA) in PC-3 cells. As a result, Erk1/2 was activated similarly to what was observed upon EGF stimulation. EGF-induced Erk1/2 activation in PC-3 cells was PKC-dependent, as demonstrated through use of a selective PKC inhibitor, GF109203X. This provides evidence for PKC regulatory control over Erk1/2 signaling downstream of EGFR. Next, we demonstrated that when PKC was inhibited by GF109203X, EGF-stimulated Erk1/2 activation was inhibited in PC-3, but not DU145 cells. TPA-stimulated Erk1/2 activation was EGFR-dependent in both DU145 and PC-3 cells, demonstrated through abrogation of Erk1/2 activation by a selective EGFR inhibitor AG1478. These data support PKC control at or upstream of EGFR in AICaP cells. We observed that interfering with ligand/EGFR binding abrogated Erk1/2 signaling in TPA-stimulated cells, revealing a role for PKC upstream of EGFR. ^ Next, we determined which PKC isozymes might be responsible for Erk1/2 regulation. We first determined that human AICaP cell lines express the same PKC isozymes as those observed in clinical prostate cancer specimens (α, ϵ, &zgr;, ι and PKD). Isozyme-selective methods were employed to characterize discrete PKC isozyme function in EGFR-dependent Erk1/2 activation. Pharmacologic inhibitors implicated PKCα in TPA-induced EGFR-dependent Erk1/2 activation in both PC-3 and DU145 cells. Further, the cPKC-specific inhibitor, Gö6976 decreased viablilty of DU145 cells, providing evidence that PKCα is necessary for growth and survival. Finally, resveratrol, a phytochemical with strong cancer therapeutic potential inhibited Erk1/2 activation, and this correlated with selective inhibition of PKCα. These results demonstrate that PKC regulates pathways critical to progression of CaP cells, including those mediated by EGFR. Thus, PKC isozyme-selective targeting is an attractive therapeutic strategy, and understanding the role of specific PKC isozymes in CaP cell growth and survival may aid in development of effective, non-toxic PKC-targeted therapies. ^

Regulation of T cell function by complement C5A in mice during mycobacterial infection

Tuberculosis is the leading cause of death in the world due to a single infectious agent, making it critical to investigate all aspects of the immune response mounted against the causative agent, Mycobacterium tuberculosis , in order to better treat and prevent disease. Previous observations show a disparity in the ability to control mycobacterial growth between mouse strains sufficient in C5, such as C57BL/6 and B10.D2/nSnJ, and those naturally deficient in C5, such as A/J and B10.D2/nSnJ, with C5 deficient mice being more susceptible. It has been shown that during M. tuberculosis infection, C5 deficient macrophages have a defect in production of interleukin (IL)-12, a cytokine involved in the cyclical activation between infected macrophages and effector T cells. T cells stimulated by IL-12 produce interferon (IFN)-γ, the signature cytokine of T helper type 1 (Th1) cells. It is known that a cell-mediated Th1 response is crucial for control of M. tuberculosis in the lungs of humans and mice. This study demonstrates that murine T cells express detectable levels of CD88, a receptor for C5a (C5aR), following antigen presentation by macrophages infected with mycobacteria. T cells from C5 deficient mice infected with M. tuberculosis were found to secrete less IFN-γ and had a reduced Th1 phenotype associated with fewer cells expressing the transcription factor, T-box expressed in T cells (T-bet). The altered Th1 phenotype in M. tuberculosis infected C5 deficient mice coincided with a rise in IL-4 and IL-10 secretion from Th2 cells and inducible regulatory T cells, respectively. It was found that the ineffective T cell response to mycobacteria in C5 deficient mice was due indirectly to a lack of C5a via poor priming by infected macrophages and possibly by a direct interaction between T cells and C5a peptide. Therefore, these studies show a link between the cells of the innate and adaptive arms of the immune system, macrophages and T cells respectively, that was mediated by C5a using a mouse model of M. tuberculosis infection. ^

Tp53-dependent repression of cell cycle target genes: Global and mechanistic analysis

Most studies of p53 function have focused on genes transactivated by p53. It is less widely appreciated that p53 can repress target genes to affect a particular cellular response. There is evidence that repression is important for p53-induced apoptosis and cell cycle arrest. It is less clear if repression is important for other p53 functions. A comprehensive knowledge of the genes repressed by p53 and the cellular processes they affect is currently lacking. We used an expression profiling strategy to identify p53-responsive genes following adenoviral p53 gene transfer (Ad-p53) in PC3 prostate cancer cells. A total of 111 genes represented on the Affymetrix U133A microarray were repressed more than two fold (p ≤ 0.05) by p53. An objective assessment of array data quality was carried out using RT-PCR of 20 randomly selected genes. We estimate a confirmation rate of >95.5% for the complete data set. Functional over-representation analysis was used to identify cellular processes potentially affected by p53-mediated repression. Cell cycle regulatory genes exhibited significant enrichment (p ≤ 5E-28) within the repressed targets. Several of these genes are repressed in a p53-dependent manner following DNA damage, but preceding cell cycle arrest. These findings identify novel p53-repressed targets and indicate that p53-induced cell cycle arrest is a function of not only the transactivation of cell cycle inhibitors (e.g., p21), but also the repression of targets that act at each phase of the cell cycle. The mechanism of repression of this set of p53 targets was investigated. Most of the repressed genes identified here do not harbor consensus p53 DNA binding sites but do contain binding sites for E2F transcription factors. We demonstrate a role for E2F/RB repressor complexes in our system. Importantly, p53 is found at the promoter of CDC25A. CDC25A protein is rapidly degraded in response to DNA damage. Our group has demonstrated for the first time that CDC25A is also repressed at the transcript level by p53. This work has important implications for understanding the DNA damage cell cycle checkpoint response and the link between E2F/RB complexes and p53 in the repression of target genes. ^

Characterization of tumor-associated Foxp3+ regulatory T cells and de-novo induction by the tumor microenvironment

Regulatory T cells expressing the fork-head box transcription factor 3 (Foxp3) play a central role in the dominant control of immunological tolerance. Compelling evidence obtained from both animal and clinical studies have now linked the expansion and accumulation of Foxp3+ regulatory T cells associated with tumor lesions to the failure of immune-mediated tumor rejection. However, further progress of the field is hampered by the gap of knowledge regarding their phenotypic, functional, and the developmental origins in which these tumor-associated Foxp3+ regulatory T cells are derived. Here, we have characterized the general properties of tumor-associated Foxp3+ regulatory T cells and addressed the issue of tumor microenvironment mediated de-novo induction by utilizing a well known murine tumor model MCA-205 in combination with our BAC Foxp3-GFP reporter mice and OT-II TCR transgenic mice on the RAG deficient background (RAG OT-II). De-novo induction defines a distinct mechanism of converting non-regulatory precursor cells to Foxp3+ regulatory T cells in the periphery as opposed to the expansion of pre-existing regulatory T cells formed naturally during thymic T cell development. This mechanism is of particularly importance to how tumors induce tumor-antigen-specific suppressor cells to subvert anti-tumor immune responses. Our study has found that tumor-associated Foxp3+ regulatory T cells are highly activated, undergo vigorous proliferation, are more potent by in-vitro suppression assays, and express higher levels of membrane-bound TGF-β1 than non-tumor regulatory T cells. With Foxp3-GFP reporter mice or RAG OT-II TCR transgenic mice, we show that tumor tissue can induce detectable de-novo generation of Foxp3+ regulatory T cells of both polyclonal or antigen specific naïve T cells. This process was not only limited for subcutaneous tumors but for lung tumors as well. Furthermore, this process required the inducing antigen to be co-localized within the tumor tissue. Examination of tumor tissue revealed an abundance of myeloid CD11b+ antigen-presenting cells that were capable of inducing Foxp3+ regulatory T cells. Taken together, these findings elucidate the general attributes and origins of tumor-associated Foxp3+ regulatory T cells in the tumor microenvironment and in their role in the negative regulation of tumor immunity.^

Proteomic identification and functional characterization of prohibitin 1 and 2 in T cell activation, expansion, survival and disease

Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^

Alterations in cell adhesion and migration are transcriptionally regulated by the tumor suppressor, TP53

The p53 transcription factor is a tumor suppressor and a master regulator of apoptosis and the cell cycle in response to cell stress. In some advanced tumors, such as prostate cancers, the loss of p53 correlates with an increase in the occurrence of metastases. In addition, several groups have suggested that p53 status correlates with changes in cell migration and cell morphology associated with a migratory phenotype. Others have identified several genes with roles in cell migration that are directly transcriptionally regulated by p53. Even so, modulation of cell migration is not widely recognized as a p53 stress response. ^ In an effort to identify novel p53 target genes and expand our knowledge of the p53 transcriptional response, we performed Affymetrix gene expression analysis in p53-null PC3 prostate cancer cells following infection with a control virus or adenoviral construct expressing wild-type p53. Over 300 genes that had not been previously recognized as p53 target genes were identified. Of these genes, 224 were upregulated and 111 were downregulated (p<0.05). Functional over-representation analysis identified cell migration as a significantly over-represented biological function of p53. Further analysis identified two genes that are critical for the control of cell migration as potential p53 targets. One, hyaluronan mediated motility receptor (HMMR), has recently been shown to be a p53 target important for regulation of the cell cycle. Here, we show that HMMR is downregulated by p53 in several cell lines, and HMMR's regulation is dependent on the presence of the cdk inhibitor, p21, and histone deactelyase activity. The other gene, carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1), itself a tumor suppressor, is shown here, for the first time, as a p53 direct target by ChIP analysis. We next determined the effect of p53 activation on cell migration and found that p53 significantly slows the rate of cell migration in Boyden chamber migration assays and digital videomicroscopy wound healing studies. Further, our studies established the specific roles of CEACAM1 and HMMR in cell migration and determine that loss of CEACAM1 and overexpression of HMMR independently contribute to increased cell migration. Taken together, these studies provide a direct mechanistic link between p53 to the regulatory control of specific target genes that mediate cell adhesion and migration. ^

Transcriptional and translational regulators of gene expression in germ cell development

Germ cell development is a highly coordinated process driven, in part, by regulatory mechanisms that control gene expression. Not only transcription, but also translation, is under regulatory control to direct proper germ cell development. In this dissertation, I have focused on two regulators of germ cell development. One is the homeobox protein RHOX10, which has the potential to be both a transcriptional and translational regulator in mouse male germ cell development. The other is the RNA-binding protein, Hermes, which functions as a translational regulator in Xenopus laevis female germ cell development. ^ Rhox10 is a member of reproductive homeobox gene X-(linked (Rhox) gene cluster, of which expression is developmentally regulated in developing mouse testes. To identify the cell types and developmental stages in which Rhox10 might function, I characterized its temporal and spatial expression pattern in mouse embryonic, neonatal, and adult tissues. Among other things, this analysis revealed that both the level and the subcellular localization of RHOX10 are regulated during germ cell development. To understand the role of Rhox10 in germ cell development, I generated transgenic mice expressing an artificial microRNA (miRNA) targeting Rhox10. While this artificial miRNA robustly downregulated RHOX10 protein expression in vitro, it did not significantly reduce RHOX10 expression in vivo. So I next elected to knockdown RHOX10 levels in spermatogonial stem cells (SSCs), which I found highly express both Rhox10 mRNA and RHOX10 protein. Using a recently developed in vitro culture system for SSCs combined with a short-hairpin RNA (shRNA) approach, I strongly depleted RHOX10 expression in SSCs. These RHOX10-depleted cells exhibited a defect in the ability to form stem cell clusters in vitro. Expression profiling analysis revealed many genes regulated by Rhox10, including many meiotic genes, which could be downstream of Rhox10 in a molecular pathway that controls SSC differentiation. ^ RNA recognition motif (RRM) containing protein, Hermes is localized in germ plasm, where dormant mRNAs are also located, of Xenopus oocytes, which implicates its role in translational regulator. To understand the function of Hermes in oocyte meiosis, I used a morpholino oligonucleotide (MO) based knockdown approach. Microinjection of Hermes MO into fully grown oocytes, which are arrested in meiotic prophase, caused acceleration of oocytes reentry into meiosis (i.e., maturation) upon progesterone induction. Using a candidate approach, I identified at least three targets of Hermes: Ringo/Spy, Xcat2, and Mos. Ringo/Spy and Mos are known to have functions in oocyte maturation, while Ringo/Spy, Xcat2 mRNA are localized in the germ plasm of oocytes, which drives germ cell specification after fertilization. This led me to propose that Hermes functions in both oocyte maturation and germ cell development through its ability to regulate 3 crucial target mRNAs. ^

Molecular epidemiological studies on genetic predispositions to squamous cell carcinoma of the head and neck

Two molecular epidemiological studies were conducted to examine associations between genetic variation and risk of squamous cell carcinoma of the head and neck (SCCHN). In the first study, we hypothesized that genetic variation in p53 response elements (REs) may play roles in the etiology of SCCHN. We selected and genotyped five polymorphic p53 REs as well as a most frequently studied p53 codon 72 (Arg72Pro, rs1042522) polymorphism in 1,100 non-Hispanic White SCCHN patients and 1,122 age-and sex-matched cancer-free controls recruited at The University of Texas M. D. Anderson Cancer Center. In multivariate logistic regression analysis with adjustment for age, sex, smoking and drinking status, marital status and education level, we observed that the EOMES rs3806624 CC genotype had a significant effect of protection against SCCHN risk (adjusted odds ratio= 0.79, 95% confidence interval =0.64–0.98), compared with the -838TT+CT genotypes. Moreover, a significantly increased risk associated with the combined genotypes of p53 codon 72CC and EOMES -838TT+CT was observed, especially in the subgroup of non-oropharyneal cancer patients. The values of false-positive report probability were also calculated for significant findings. In the second study, we assessed the association between SCCHN risk and four potential regulatory single nucleotide polymorphisms (SNPs) of DEC1 (deleted in esophageal cancer 1) gene, a candidate tumor suppressor gene for esophageal cancer. After adjustment for age, sex, and smoking and drinking status, the variant -606CC (i.e., -249CC) homozygotes had a significantly reduced SCCHN risk (adjusted odds ratio = 0.71, 95% confidence interval = 0.52–0.99), compared with the -606TT homozygotes. Stratification analyses showed that a reduced risk associated with the -606CC genotype was more pronounced in subgroups of non-smokers, non-drinkers, younger subjects (defined as ≤ 57 years), carriers of TP53 Arg/Arg (rs1042522) genotype, patients with oropharyngeal cancer or late-stage SCCHN. Further in silico analysis revealed that the -249 T-to-C change led to a gain of a transcription factor binding site. Additional functional analysis showed that the -249T-to-C change significantly enhanced transcriptional activity of the DEC1 promoter and the DNA-protein binding activity. We conclude that the DEC1 promoter -249 T>C (rs2012775) polymorphism is functional, modulating susceptibility to SCCHN among non-Hispanic Whites. Additional large-scale, preferably population-based studies are needed to validate our findings.^

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE

IMMUNOLOGICAL MECHANISMS OF EXTRACORPOREAL PHOTOPHERESIS IN CUTANEOUS T CELL LYMPHOMA AND GRAFT VERSUS HOST DISEASE Publication No.___________ Lisa Harn-Ging Shiue, B.S. Supervisory Professor: Madeleine Duvic, M.D. Extracorporeal photopheresis (ECP) is an effective, low-risk immunomodulating therapy for leukemic cutaneous T cell lymphoma (L-CTCL) and graft versus host disease (GVHD), but whether the mechanism(s) of action in these two diseases is (are) identical or different is unclear. To determine the effects of ECP in vivo, we studied regulatory T cells (T-regs), cytotoxic T lymphocytes (CTLs), and dendritic cells (DCs) by immunofluorescence flow cytometry in 18 L-CTCL and 11 GVHD patients before and after ECP at Day 2, 1 month, 3 months, and 6 months. In this study, ECP was effective in 12/18 L-CTCL patients with a 66.7% overall response rate (ORR) and 6/11 GVHD patients with a 54.5% ORR. Prior to ECP, the percentages of CD4+Foxp3+ T cells in 9 L-CTCL patients were either lower (L-CTCL-Low, n=2) or higher (L-CTCL-High, n=7) than normal. Five of the 7 GVHD patients had high percentages of CD4+Foxp3+ T cells (GVHD-High). Six of 7 L-CTCL-High patients had >80% CD4+Foxp3+ T cells which were correlated with tumor cells, and were responders. Both L-CTCL-High and GVHD-High patients had decreased percentages of CD4+Foxp3+ and CD4+Foxp3+CD25- T cells after 3 months of treatment. CD4+Foxp3+CD25+ T cells increased in GVHD-High patients but decreased in L-CTCL-High patients after 3 months of ECP. In addition, numbers of CTLs were abnormal. We confirmed that numbers of CTLs were low in L-CTCL patients, but high in GVHD patients prior to ECP. After ECP, CTLs increased after 1 month in 4/6 L-CTCL patients whereas CTLs decreased after 6 months in 3/3 GVHD patients. Myeloid (mDCs) and plasmacytoid DCs (pDCs) were also low at baseline in L-CTCL and GVHD patients confirming the DC defect. After 6 months of ECP, numbers and percentages of mDCs and pDCs increased in L-CTCL and GVHD. MDCs were favorably increased in 8/12 L-CTCL responders whereas pDCs were favorably increased in GVHD patients. These data suggest that ECP is favorably modulating the DC subsets. In L-CTCL patients, the mDCs may orchestrate Th1 cell responses to overcome immune suppression and facilitate disease regression. However, in GVHD patients, ECP is favorably down-regulating the immune system and may be facilitating immune tolerance to auto-or allo-antigens. In both L-CTCL and GVHD patients, DCs are modulated, but the T cell responses orchestrated by the DCs are different, suggesting that ECP modulates depending on the immune milieu. _______________

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Growth regulatory role of R -PTPmu in normal and neoplastic epithelial cells

Cellular oncogenes and tumor suppressor genes regulate cellular adhesion and proliferation, two important events in malignant transformation. Even though receptor-like protein tyrosine phosphatases (R-PTPs) can influence these events, their role in malignant transformation has not been studied. The major goal of this study was to determine whether downregulation of R-PTP$\mu$ expression in lung epithelial cells is associated with or causal to neoplastic transformation. Examination of R-PTP$\mu$ expression in normal and carcinoma cells demonstrated that lung epithelial cells expressed R-PTP$\mu$ whereas lung carcinoma cells did not, and that incubation with TGF-$\alpha$ and HGF induced a two fold increase in R-PTP$\mu$ mRNA expression. To associate the expression of R-PTP$\mu$ with neoplastic transformation, we transfected lung epithelial cells with the H-ras oncogene. Transformation resulted in the activation of the MAPK signal transduction pathway, the hyperphosphorylation of c-met, and the production of HGF. Upon analysis of R-PTP$\mu$ expression, we observed a significant decrease in R-PTP$\mu$ mRNA and protein levels suggesting that transformation can directly or indirectly downregulate the expression of R-PTP$\mu.$ TGF-$\beta$ reversed the H-ras transformed phenotype, an event directly correlated with upregulation of R-PTP$\mu.$ To provide a casual relationship between R-PTP$\mu$ and cessation of tumor cell growth, we transfected carcinoma cells with the wild type R-PTP$\mu$ cDNA. Transiently expressing cells were selected by FACS using the mAb 3D7 and plated into individual wells. Carcinoma cells positive for R-PTP$\mu$ expression did not grow into colonies whereas non-R-PTP$\mu$ expressing carcinoma cells did, suggesting that expression of R-PTP$\mu$ arrested cell growth. To better understand the growth arrest induced by R-PTP$\mu$, we transfected the H-ras transformed lung epithelial cell line (MvLu-1-ras) with R-PTP$\mu$ (MvLu-1-ras/R-PTP$\mu$). Examination of growth factor receptor phosphorylation revealed significant inhibition of c-met and EGF-R. Furthermore, these cells underwent apoptosis in the absence of serum. Taken together the data demonstrate that the downregulation of R-PTP$\mu$ expression is an important step in neoplastic transformation of lung epithelial cells and that its presence can induce apoptosis and inhibit the signaling of c-met and EGF-R, two major growth factor receptors in lung carcinoma. In conclusion, the expression of R-PTP$\mu$ is inversely correlated with neoplastic transformation, growth and survival of tumor cells. ^

The role of Ski/Sno oncoproteins as negative regulators of the TGF-beta/SMAD signaling pathway in B -cell non -Hodgkin's lymphoma (NHL-B)

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Molecular mechanisms involved in the regulation of cell polarity and genome stability by the p21 -activated kinase, Shk1, in the fission yeast, Schizosaccharomyces pombe

The essential p21-activated kinase (PAK), Shk1, is a critical component of a Ras/Cdc42/PAK complex required for cell viability, normal cell polarity, proper regulation of cytoskeletal dynamics, and sexual differentiation in the fission yeast, Schizosaccharomyces pombe. While cellular functions of PAKs have been described in eukaryotes from yeasts to mammals, the molecular mechanisms of PAK regulation and function are poorly understood. This study has characterized a novel Shk1 inhibitor, Skb15, and, in addition, identified the cell polarity regulator, Tea1, as a potential biological substrate of Shk1 in S. pombe. Skb15 is a highly conserved WD repeat protein that was discovered from a two-hybrid screen for proteins that interact with the catalytic domain of Shk1. Molecular data indicate that Skb15 negatively regulates Shk1 kinase activity in S. pombe cells. A null mutation in the skb15 gene is lethal and results in deregulation of actin polymerization and localization, microtubule biogenesis, and the cytokinetic machinery, as well as a substantial uncoupling of these processes from the cell cycle. Loss of Skb15 function is suppressed by partial loss of Shk1, demonstrating that negative regulation of Shk1 by Skb15 is required for proper execution of cytoskeletal remodeling and cytokinetic functions. A mouse homolog of Skb15 can substitute for its counterpart in fission yeast, demonstrating that Skb15 protein function has been substantially conserved through evolution. ^ Our laboratory has recently demonstrated that Shk1, in addition to regulating actin cytoskeletal organization, is required for proper regulation of microtubule dynamics in S. pombe cells. The Shk1 protein localizes to interphase and mitotic microtubules, the septum-forming region, and cell ends. This pattern of localization overlaps with that of the cell polarity regulator, Tea1, in S. pombe cells. The tea1 gene was identified by Paul Nurse's laboratory from a screen for genes involved in the control of cell morphogenesis in S. pombe. In contrast to wild type S. pombe cells, which are rod shaped, tea1 null cells are often bent and/or branched in shape. The Tea1 protein localizes to the cell ends, like Shk1, and the growing tips of interphase microtubules. Thus, experiments were performed to investigate whether Tea1 interacts with Shk1. The tea1 null mutation strongly suppresses the loss of function of Skb15, an essential inhibitor of Shk1 function. All defects associated with the skb15 mutation, including defects in F-actin organization, septation, spindle elongation, and chromosome segregation, are suppressed by tea1Δ, suggesting that Tea1 may function in these diverse processes. Consistent with a role for Tea1 in cytokinesis, tea1Δ cells have a modest cell separation defect that is greatly exacerbated by a shk1 mutation and, like Shk1, Tea1 localizes to the septation site. Molecular analyses showed that Tea1 phosphorylation is significantly dependent on Shk1 function in vivo and that bacterially expressed Tea1 protein is directly phosphorylated by recombinant Shk1 kinase in vitro. Taken together, these results identify Tea1 as a potential biological substrate of Shk1 in S. pombe. ^ In summary, this study provides new insights into a conserved regulatory mechanism for PAKs, and also begins to uncover the molecular mechanisms by which the Ras/Cdc42/PAK complex regulates the microtubule and actin cytoskeletons and cell growth polarization in fission yeast. ^

Evolution of cis-regulatory elements in a repetitive sequence adjacent to a sea urchin aboral ectoderm -specific gene

The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. In this study, critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes were identified and explored. In genomes of species within the Strongylocentrotidae family, multiple copies of a repetitive sequence element termed RSR were present, but RSRs were not detected in genomes of species outside Strongylocentrotidae. RSRs are invariably associated with spec genes, and in Strongylocentrotus purpuratus, the spec2a RSR functioned as a transcriptional enhancer displaying greater activity than RSRs from the spec1 or spec2c paralogs. Single base-pair differences at two cis-regulatory elements within the spec2a RSR greatly increased the binding affinities of four transcription factors: SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which SpCCAAT-binding factor, SpOtx, SpGoosecoid, and SpGATA-E bound were recent evolutionary acquisitions that could act either to activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in the RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. These results indicate that spec genes exhibit a dynamic pattern of cis-regulatory element evolution while stabilizing selection preserves their aboral ectoderm expression domain. ^