26 resultados para Regulatory T Cells


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Glomerular mesangial cells (MC) are renal vascular cells that regulate the surface area of glomerular capillaries and thus, partly control glomerular filtration rate. Clarification of the signal transduction pathways and ionic mechanisms modulating MC tone are critical to understanding the physiology and pathophysiology of these cells, and the integrative role these cells play in fluid and electrolyte homeostasis. The patch clamp technique and an assay of cell concentration were used to electrophysiologically and pharmacologically analyze the ion channels of the plasmalemmal of human glomerular MC maintained in tissue culture. Moreover, the signal transduction pathways modulating channels involved in relaxation were investigated. Three distinct K$\sp+$-selective channels were identified: two low conductance channels (9 and 65pS) maintained MC at rest, while a larger conductance (206pS) K$\sp+$ channel was quiescent at rest. This latter channel was pharmacologically and biophysically similar to the large, Ca$\sp{2+}$-activated K$\sp+$ channel (BK$\rm\sb{Ca}$) identified in smooth muscle. BK$\rm\sb{Ca}$ played an essential role in relaxation of MC. In cell-attached patches, the open probability (P$\rm\sb{o}$) of BK$\rm\sb{Ca}$ increased from a basal level of $<$0.05 to 0.22 in response to AII (100nM)-induced mobilization of cytosolic Ca$\sp{2+}$. Activation in response to contractile signals (membrane depolarization and Ca$\sp{2+}$ mobilization) suggests that BK$\rm\sb{Ca}$ acts as a low gain feedback regulator of contraction. Atrial natriuretic factor (ANF; 1.0$\mu$M) and nitroprusside (NP; 0.1mM), via the second messenger, cGMP, increase the feedback gain of BK$\rm\sb{Ca}$. In cell-attached patches bathed with physiological saline, these agents transiently activated BK$\rm\sb{Ca}$ from a basal $\rm P\sb{o}<0.05$ to peak responses near 0.50. As membrane potential hyperpolarizes towards $\rm E\sb{K}$ (2-3 minutes), BK$\rm\sb{Ca}$ inactivates. Upon depolarizing V$\rm\sb{m}$ with 140 mM KCl, db-cGMP (10$\mu$M) activated BK$\rm\sb{Ca}$ to a sustained P$\rm\sb{o}$ = 0.51. Addition of AII in the presence of cGMP further increased P$\rm\sb{o}$ to 0.82. Activation of BK$\rm\sb{Ca}$ by cGMP occured via an endogenous cGMP-dependent protein kinase (PKG): in excised, inside-out patches, PKG in the presence of Mg-ATP (0.1mM) and cGMP increased P$\rm\sb{o}$ from 0.07 to 0.39. In contrast, neither PKC nor PKA influenced BK$\rm\sb{Ca}$. Endogenous okadaic acid-sensitive protein phosphatase suppressed BK$\rm\sb{Ca}$ activity. Binning the change in P$\rm\sb{o}\ (\Delta P\sb{o}$) of BK$\rm\sb{Ca}$ in response to PKG (n = 69) established two distinct populations of channels: one that responded ($\cong$67%, $\rm\Delta P\sb{o} = 0.45 \pm 0.03$) and one that was unresponsive ($\Delta\rm P\sb{o} = 0.00 \pm 0.01$) to PKG. Activation of BK$\rm\sb{Ca}$ by PKG resulted from a decrease in the Ca$\sp{2+}$- and voltage-activation thresholds independent of sensitivities. In conclusion, mesangial BK$\rm\sb{Ca}$ channels sense both electrical and chemical signals of contraction and act as feedback regulators by repolarizing the plasma membrane. ANF and NO, via cGMP, stimulate endogenous PKG, which subsequently decreases the activation threshold of BK$\rm\sb{Ca}$ to increase the gain of this feedback regulatory signal. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Glutamate is the major excitatory neurotransmitter in the retina and serves as the synaptic messenger for the three classes of neurons which constitute the vertical pathway--the photoreceptors, bipolar cells and ganglion cells. In addition, the glutamate system has been localized morphologically, pharmacologically as well as molecularly during the first postnatal week of development before synaptogenesis occurs. The role which glutamate plays in the maturing visual system is complex but ranges from mediating developmental neurotoxicity to inducing neurite outgrowth.^ Nitric oxide/cGMP is a novel intercellular messenger which is thought to act in concert with the glutamate system in regulating a variety of cellular processes in the brain as well as retina, most notably neurotoxicity. Several developmental activities including programmed cell death, synapse elimination and synaptic reorganization are possible functions of cellular regulation modulated by nitric oxide as well as glutamate.^ The purpose of this thesis is to (1) biochemically characterize the endogenous pools of glutamate and determine what fraction exists extracellularly; (2) examine the morphological expression of NO producing cells in developing retina; (3) test the functional coupling of the NMDA subtype of glutamate receptor to the NO system by examining neurotoxicity which has roles in both the maturing and adult retina.^ Biochemical sampling of perfusates collected from the photoreceptor surface of ex vivo retina demonstrated that although the total pool of glutamate present at birth is relatively modest, a high percentage resides in extracellular pools. As a result, immature neurons without significant synaptic connections survive and develop in a highly glutamatergic environment which has been shown to be toxic in the adult retina.^ The interaction of the glutamate system with the NO system has been postulated to regulate neuronal survival. We therefore examined the developmental expression of the enzyme responsible for producing NO, nitric oxide synthase (NOS), using an antibody to the constitutive form of NOS found in the brain. The neurons thought to produce the majority of NO in the adult retina, a subpopulation of widefield amacrine cells, were not immunoreactive until the end of the second postnatal week. However, a unique developmental expression was observed in the ganglion cell layer and developing outer nuclear layer of the retina during the first postnatal week. We postulate NO producing neurons may not be present in a mature configuration therefore permitting neuronal survival in a highly glutamatergic microenvironment and allowing NO to play a development-specific role at this time.^ The next set of experiments constituted a functional test of the hypothesis that the absence of the prototypic NO producing cells in developing retina protects immature neurons against glutamate toxicity. An explant culture system developed in order to examine cellular responses of immature and adult neurons to glutamate toxicity showed that immature neurons were affected by NMDA but were less responsive to NMDA and NO mediated toxicity. In contrast, adult explants exhibited significant NMDA toxicity which was attenuated by NMDA antagonists, 2-amino-5-phosphonovaleric acid (APV), dextromethorphan (Dex) and N$\rm\sp{G}$-D-methyl arginine (metARG). These results indicated that pan-retinal neurotoxicity via the NMDA receptor and/or NO activation occurred in the adult retina but was not significant in the neonate. (Abstract shortened by UMI.) ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Bcr-Abl fusion oncogene which resulted from a balanced reciprocal translocation between chromosome 9 and 22, t(9;22)(q11, q34), encodes a 210 KD elevated tyrosine specific protein kinase that is found in more than 95 percent of chronic myelogenous leukemia patients (CML). Increase of level of phosphorylation of tyrosine is observed on cell cycle regulatory proteins in cells overexpressing the Bcr-Abl oncogene, which activates multiple signaling pathways. In addition, distinct signals are required for transforming susceptible fibroblast and hematopoietic cells, and the minimal signals essential for transforming hematopoietic cells are yet to be defined. In the present study, we first established a tetracycline repressible p210$\rm\sp{bcr-abl}$ expression system in a murine myeloid cell line 32D c13, which depends on IL3 to grow in the presence of tetracycline and proliferate independent of IL3 in the absence of tetracycline. Interestingly, one of these sublines does not form tumors in athymic nude mice suggesting that these cells may not be completely transformed. These cells also exhibit a dose-dependent growth and expression of p210$\rm\sp{bcr-abl}$ at varying concentrations of tetracycline in the culture. However, p210$\rm\sp{bcr-abl}$ rescues IL3 deprivation induced apoptosis in a non-dose dependent fashion. DNA genotoxic damage induced by gamma-irradiation activates c-Abl tyrosine kinase, the cellular homologue of p210$\rm\sp{bcr-abl},$ and leads to activation of p38 MAP kinase in the cells. However, in the presence of p210$\rm\sp{bcr-abl}$ the irradiation failed to activate the p38 MAP kinase as examined by an antibody against phosphorylated p38 MAP kinase. Similarly, an altered tyrosine phosphorylation of the JAK1-STAT1 pathways was identified in cells constitutively overexpressing p210$\rm\sp{bcr-abl}.$ This may provided a molecular mechanism for altered therapeutic response of CML patients to IFN-$\alpha.$^ Bcr-Abl oncoprotein has multiple functional domains which have been identified by the work of others. The Bcr tetramerization domain, which may function to stabilize the association of the Bcr-Abl with actin filaments in p210$\rm\sp{bcr-abl}$ susceptible cells, are essential for transforming both fibroblast and hematopoietic cells. We designed a transcription unit encoding first 160 amino acids polypeptide of Bcr protein to test if this polypeptide can inhibit the transforming activity of the p210$\rm\sp{bcr-abl}$ oncoprotein in the 32D c13 cells. When this vector was transfected transiently along with the p210$\rm\sp{bcr-abl}$ expression vector, it can block the transforming activity of p210$\rm\sp{bcr-abl}.$ On the other hand, the retinoblastoma tumor suppressor protein (Rb), a naturally occurring negative regulator of the c-Abl kinase, the cellular homologue of Bcr-Abl oncoprotein, binds to and inhibits the c-Abl kinase in a cell cycle dependent manner. A polypeptide obtained from the carboxyl terminal end of the retinoblastoma tumor suppressor protein, in which the nuclear localization signal was mutated, was used to inhibit the kinase activity of the p210$\rm\sp{bcr-abl}$ in the cytoplasm. This polypeptide, called Rb MC-box, and its wild type form, Rb C-box, when overexpressed in the 32D cells are mainly localized in the cytoplasm. Cotransfection of a plasmid transcription unit coding for this polypeptide and the gene for the p210$\rm\sp{bcr-abl}$ resulted in reduced plating efficiency of p210$\rm\sp{bcr-abl}$ transfected IL3 independent 32D cells. Together, these results may lead to a molecular approach to therapy of CML and an in vitro assay system to identify new targets to which an inhibitory polypeptide transcription unit may be directed. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Although many clinical trials investigated the use of IL-2, IL-12, and LAK in adoptive immunotherapy to treat cancer, only limited clinical success has been achieved. Better understanding of the intracellular processes that IL-2 and IL-12 utilize to generate LAK and other functions in NK cells is necessary to improve this mode of therapy. IL-2 and IL-12 stimulate extracellular signal-regulated protein kinase (ERK) and p38 MAPK in mitogen-activated T lymphocytes. The functional roles that these kinases play are still unclear. In this study, we examined whether MAPK Kinase (MKK)/ERK and/or p38 MAPK pathways are necessary for IL-2 or IL-12 to activate NK cells. We established that IL-2 activates MKK1/2/ERK pathway in freshly isolated human NK cells without any prior stimulation. Furthermore, we determined that an intact MKK/ERK pathway is necessary for IL-2 to activate NK cells to express at least four known biological responses: LAK activity, IFN-γ secretion, and CD25 and CD69 expression. Treatment of NK cells with a specific inhibitor of MKK1/2 PD98059, during the IL-2 stimulation blocked in a dose-dependent manner each of four activation parameters. Although activation of ERK was not detected in NK cells immediately after IL-12 stimulation, IL-12-induced functional activation was inhibited by the MKK1/2 inhibitor, as well. In contrast to what was observed by others in T lymphocytes, activation of p38 MAPK by IL-2 was not detected in NK cells. Additionally, a specific inhibitor of p38 MAPK (SB203850) did not inhibit IL-2-activated NK functions. These data reveal selective signaling differences between NK cells and T lymphocytes. Collectively, the data support that the MKK/ERK pathway plays a critical positive regulatory role in NK cells during activation by IL-2 and IL-12. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The MUC1 gene encodes a transmembrane mucin glycoprotein that is overexpressed in several cancers of epithelial origin, including those of breast, pancreas, lung, ovary, and colon. Functions of MUC1 include protection of mucosal epithelium, modulation of cellular adhesion, and signal transduction. Aberrantly increased expression of MUC1 in cancer cells promotes tumor progression through adaptation of these functions. Some regulatory elements participating in MUC1 transcription have been described, but the mechanisms responsible for overexpression are largely unknown. A region of MUC1 5′ flanking sequence containing two conserved potential cytokine response elements, an NFκB site at −589/−580 and a STAT binding element (SBE) at −503/−495, has been implicated in high level expression in breast and pancreatic cancer cell lines. Persistent stimulation by proinflammatory cytokines may contribute to increased MUC1 transcription by tumor cells. ^ T47D breast cancer cells and normal human mammary epithelial cells (HMEC) were used to determine the roles of the κB site and SBE in basal and stimulated expression of MUC1. Treatment of T47D cells and HMEC with interferon-γ (IFNγ) alone enhanced MUC1 expression at the level of transcription, and the effect of IFNγ was further stimulated by tumor necrosis factor-α (TNFα). MUC1 responsiveness to these cytokines was modest in T47D cells but clearly evident in HMEC. Transient transfection of T47D cells with mutant MUC1 promoter constructs revealed that the κB site at −589/−580 and the SBE at −503/−495 and were required for cooperative stimulation by TNFα and IFNγ. Electrophoretic mobility shift assays (EMSA) revealed that the synergy was mediated not by cooperative binding of transcription factors but by the independent actions of STAT1α and NFκB p65 on their respective binding sites. Independent mutations in the κB site and SBE abrogated cytokine responsiveness and reduced basal MUC1 promoter activity by 45–50%. However, only the κB site appeared to be constitutively activated in T47D cells, in part by NFκB p65. These findings implicate two cytokine response elements in the 5 ′ flanking region of MUC1, specifically a κB site and a STAT binding element, in overexpression of MUC1 in breast cancer cells. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Most human tumors contain a population of cells with stem cell properties, called cancer stem cells (CSCs), which are believed to be responsible for tumor establishment, metastasis, and resistance to clinical therapy. It’s crucial to understand the regulatory mechanisms unique to CSCs, so that we may design CSC-specific therapeutics. Recent discoveries of microRNA (miRNA) have provided a new avenue in understanding the regulatory mechanisms of cancer. However, how miRNAs may regulate CSCs is still poorly understood. Here, we present miRNA expression profiling in six populations of prostate cancer (PCa) stem/progenitor cells that possess distinct tumorigenic properties. Six miRNAs were identified to be commonly and differentially expressed, namely, four miRNAs (miR-34a, let-7b, miR-106a and miR-141) were under-expressed, and two miRNAs (miR-301 and miR-452) were over-expressed in the tumorigenic subsets compared to the corresponding marker-negative subpopulations. Among them, the expression patterns of miR-34, let-7b, miR-141 and miR-301 were further confirmed in the CD44+ human primary prostate cancer (HPCa) samples. We then showed that miR-34a functioned as a critical negative regulator in prostate CSCs and PCa development and metastasis. Over-expression of miR-34a in either bulk or CD44+ PCa cells significantly suppressed clonal expansion, tumor development and metastasis. Systemic delivery of miR-34a in tumor-bearing mice demonstrated a potent therapeutic effect again tumor progression and metastasis, leading to extended animal survival. Of great interest, we identified CD44 itself as a direct and relevant downstream target of miR-34a in mediating its tumor-inhibitory effects. Like miR-34a, let-7 manifests similar tumor suppressive effects in PCa cells. In addition, we observed differential mechanisms between let-7 and miR-34a on cell cycle, with miR-34a mainly inducing G1 cell-cycle arrest followed by cell senescence and let-7 inducing G2/M arrest. MiR-301, on the other hand, exerted a cell type dependent effect in regulating prostate CSC properties and PCa development. In summary, our work reveals that the prostate CSC populations display unique miRNA expression signatures and different miRNAs distinctively and coordinately regulate various aspects of CSC properties. Altogether, our results lay a scientific foundation for developing miRNA-based anti-cancer therapy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Embryonic stem cells (ESCs) possess two unique characteristics: infinite self-renewal and the potential to differentiate into almost every cell type (pluripotency). Recently, global expression analyses of metastatic breast and lung cancers revealed an ESC-like expression program or signature, specifically for cancers that are mutant for p53 function. Surprisingly, although p53 is widely recognized as the guardian of the genome, due to its roles in cell cycle checkpoints, programmed cell death or senescence, relatively little is known about p53 functions in normal cells, especially in ESCs. My hypothesis is that p53 has specific transcription regulatory functions in human ESCs (hESCs) that a) oppose pluripotency and b) protect the stem cell genome in response to DNA damage and stress signaling. In mouse ESCs, these roles are believed to coincide, as p53 promotes differentiation in response to DNA damage, but this is unexplored in hESCs. To determine the biological roles of p53, specifically in hESCs, we mapped genome-wide chromatin interactions of p53 by chromatin immunoprecipitation and massively parallel tag sequencing (ChIP-Seq), and did so under three VIdifferent conditions of hESC status: pluripotency, differentiation-initiated and DNA-damage-induced. ChIP-Seq showed that p53 is enriched at distinct, induction-specific gene loci during each of these different conditions. Microarray gene expression analysis and functional annotation of the distinct p53-target genes revealed that p53 regulates specific genes encoding developmental regulators, which are expressed in differentiation-initiated but not DNA- damaged hESCs. We further discovered that, in response to differentiation signaling, p53 binds regions of chromatin that are repressed but also poised for rapid activation by core pluripotency factors OCT4 and NANOG in pluripotent hESCs. In response to DNA damage, genes associated with migration and motility are targeted by p53; whereas, the prime targets of p53 in control of cell death are conserved for p53 regulation in both differentiation and DNA damage. Our genome-wide profiling and bioinformatics analyses show that p53 occupies a special set of developmental regulatory genes during early differentiation of hESCs and functions in an induction-specific manner. In conclusion, our research unveiled previously unknown functions of p53 in ESC biology, which augments our understanding of one of the most deregulated proteins in human cancers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Electrical synapses formed of the gap junction protein Cx36 show a great deal of functional plasticity, much dependent on changes in phosphorylation state of the connexin. However, gap junction turnover may also be important for regulating cell-cell communication, and turnover rates of Cx36 have not been studied. Connexins have relatively fast turnover rates, with short half-lives measured to be 1.5 to 3.5 hours in pulse-chase analyses of connexins (Cx26 and Cx43) in tissue culture cells and whole organs. We utilized HaloTag technology to study the turnover rate of Cx36 in transiently transfected HeLa cells. The HaloTag protein forms irreversible covalent bonds with chloroalkane ligands, allowing pulse-chase experiments to be performed very specifically. The HaloTag open reading frame was inserted into an internal site in the C-terminus of Cx36 designed not to disrupt the regulatory phosphorylation sites and not to block the C-terminal PDZ interaction motif. Functional properties of Cx36-Halo were assessed by Neurobiotin tracer coupling, live cell imaging, and immunostaining. For the pulse-chase study, transiently transfected HeLa cells were pulse labeled with Oregon Green (OG) HaloTag ligand and chase labeled at various times with tetramethylrhodamine (TMR) HaloTag ligand. Cx36-Halo formed large junctional plaques at sites of contact between transfected HeLa cells and was also contained in a large number of intracellular vesicles. The Cx36-Halo transfected HeLa cells supported Neurobiotin tracer coupling that was regulated by activation and inhibition of PKA in the same manner as wild-type Cx36 transfected cells. In the pulse-chase study, junctional protein labeled with the pulse ligand (OG) was gradually replaced by newly synthesized Cx36 labeled with the chase ligand (TMR). The half-life for turnover of protein in junctional plaques was 2.8 hours. Treatment of the pulse-labeled cells with Brefeldin A (BFA) prevented the addition of new connexins to junctional plaques, suggesting that the assembly of Cx36 into gap junctions involves the traditional ER-Golgi-TGN-plasma membrane pathway. In conclusion, Cx36-Halo is functional and has a turnover rate in HeLa cells similar to that of other connexins that have been studied. This turnover rate is likely too slow to contribute substantially to short-term changes in coupling of neurons driven by transmitters such as dopamine, which take minutes to achieve. However, turnover may contribute to longer-term changes in coupling.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^