The effect of v-{\it mos\/} expression on the regulation of the {\it fos\/} promoter in 490N3T cells

The v-mos oncogene acquired by Moloney murine sarcoma viruses by recombination with the c-mos proto-oncogene encodes a 37kD cytoplasmic serine/threonine protein kinase which can phosphorylate tubulin and vimentin, as well as the cyclin B component of the maturation promotion factor complex (MPF). Our earliest experiments asked whether the v-mos protein could activate the transcription of transin. Since the transcription of transin was known to be mediated by both fos-dependent and fos-independent pathways, it seemed possible that the induction of transin transcription by v-mos might be mediated by p55$\sp{\rm c-}\sp{fos}$. Surprisingly, when we examined the effect of v-mos on the fos promoter, we observed a significant inhibition of transcription in 49ON3T cells, a subclone of N1H3T3 mouse fibroblasts.^ In this thesis we show that in mouse 49ON3T cells, transcription from the fos promoter is up to 10-fold repressed in the presence of v-mos. Moreover, in this cell line several other transforming constructs (v-ras, v-src, neu) also cause repression of the fos promoter. Interestingly, nontransforming oncogenes (e.g. myc) do not repress fos transcription. The repressive effect was lost in v-mos mutants lacking in ATP-binding or kinase domain, arguing that the effect on fos transcription was mediated by v-mos transforming kinase activity. As mos is a cytoplasmic protein, it was assumed that transcriptional repression was mediated by conversion of a transcriptional regulator to a repressor by mos-induced phosphorylation. As a first approximation of the identity of this factor, we mapped the position of the mos effect on the fos promoter using reporter (CAT) constructs. We found that repression was mediated by regions $-$221 to $-$106 and $-$122 to $-$65 relative to the fos transcriptional start site, both of which regions regulate baseline fos transcription. There are direct repeats containing E2F transcriptional activator/repressor recognition motifs in these regions which bind similar nuclear proteins independently of v-mos presence or absence. Our data show that the contribution of the direct repeat to baseline fos transcription is mediated by these E2F sites with perhaps some contribution from the overlapping retinoblastoma control element (RCE). We have shown that there is a separate DNA protein interaction in the direct repeat which is more pronounced in the presence of v-mos. The recognition site for this protein, which we speculate mediates the mos-induced downregulation of fos transcription, overlaps but is distinct from the E2F and RCE binding sites. (Abstract shortened by UMI.) ^

Studies of subcellular localization and complex formation of the Agrobacterium tumefaciens transport ATPase VirB11

The VirB11 ATPase is an essential component of an Agrobacterium tumefaciens type IV bacterial secretion system that transfers oncogenic nucleoprotein complexes to susceptible plant cells. This dissertation investigates the subcellular localization and homo-oligomeric state of the VirB11 ATPase in order to provide insights about the assembly of the protein as a subunit of this membrane-associated transfer system. Subcellular fractionation studies and quantitative immunoblot analysis demonstrated that $\sim$30% of VirB11 partitioned as soluble protein and $\sim$70% was tightly associated with the bacterial cytoplasmic membrane. No differences were detected in VirB11 subcellular localization and membrane association in the presence or absence of other transport system components. Mutations in virB11 affecting protein function were mapped near the amino terminus, just upstream of a region encoding a Walker 'A' nucleotide-binding site, and within the Walker 'A' motif partitioned almost exclusively with the cytoplasmic membrane, suggesting that an activity associated with nucleotide binding could modulate the affinity of VirB11 for the cytoplasmic membrane. Merodiploid analysis of VirB11 mutant and truncation derivatives provided strong evidence that VirB11 functions as a homo- or heteromultimer and that the C-terminal half of VirB11 contains a protein interaction domain. A combination of biochemical and molecular genetic approaches suggested that VirB11 and the green fluorescence protein (GFP) formed a mixed multimer as demonstrated by immunoprecipitation experiments with anti-GFP antibodies. Second, a hybrid protein composed of VirB11 fused to the N-terminal DNA-binding domain of bacteriophage $\lambda$ cI repressor conferred immunity to $\lambda$ superinfection, demonstrating that VirB11 self-association promotes dimerization of the chimeric repressor. A conserved Walker 'A' motif, though required for VirB11 function in T-complex export, was not necessary for VirB11 self-association. Sequences in both the N- and the C-terminal halves of the protein were found to contribute to self-association of the full length protein. Chemical cross-linking experiments with His$\sb6$ tagged VirB11 suggested that VirB11 probably assembles into a higher order homo-oligomeric complex. ^

A study in the molecular and cellular functions of GSK3beta in prostate adenocarcinoma

Kinases are part of a complex network of signaling pathways that enable a cell to respond to changes in environmental conditions in a regulated and coordinated way. For example, Glycogen Synthase Kinase 3 beta (GSK3β) modulates conformational changes, protein-protein interaction, protein degradation, and activation of unique domains in proteins that transduce signals from the extracellular milieu to the nucleus. ^ In this project, I investigated the expression and function that GSK3β exhibits in prostate cells. The capacity of GSK3β to regulate two transcription factors (JUN and CREB), which are known to be inversely utilized in prostate tumor cells, was measured. JUN/AP1 is constitutively activated in PC-3 cells; whereas, CREB/CRE activity is ∼20 fold less than the former. GSK3β overexpression obliterates JUN/AP1 activity. With respect to CREB GSK3β increases CREB/CRE activity. Cellular levels of active GSK3β can determine whether JUN or CREB is preferentially active in the PC-3s. Theoretically, in response to a particular cellular context or stimulus, a cell may coordinate JUN and CREB function by regulating GSK3β.^ A comparison of various prostate cell lines showed that active GSK3β is less expressed in normal prostate epithelial cells than in tumor cells. Differentially expressed active (GSK3β) may correlate with progression of prostate carcinoma. If a known marker associated with carcinoma of the prostate could be shown to be regulated by GSK3β then, further study of GSK3β may lead to a better understanding of both possible prevention of the disease and improved therapy for advanced stages. ^ The androgen receptor (AR) is an intriguing phosphoprotein whose regulation is potentially determined by a variety of kinases. One of these is (GSK3β) I found that (GSK3β) is a regulator of the androgen receptor in both the unliganded and liganded states. It can inhibit AR function as measured by reporter assays. Also, GSK3β associates with the AR at the DNA binding domain because deletion constructs expressing either the n-terminus or the c-terminus (both having the DBD in common) immunoprecipitated with GSK3β. Increased understanding of how GSK3β functions in prostate cancer would provide clues into how (1) certain signal pathways are coordinated and (2) the androgen receptor may be regulated. ^

Xp95 is phosphorylated within the proline rich domain during Xenopus oocyte maturation

Xp95 is the Xenopus ortholog of a conserved family of scaffold proteins that have in common an N-terminal Bro1 domain and a C-terminal proline rich domain (PRD). The regulation of this protein family is poorly understood. We previously showed that Xp95 undergoes a phosphorylation-dependant gel mobility shift during meiotic maturation of Xenopus oocytes, the only natural biological system in which post-translational modifications of this family has been demonstrated. Here we characterized Xp95 phosphorylation via two approaches. First, we tested a series of Xp95 fragments for the ability to gel-shift during oocyte maturation, and found that a fragment containing amino acids 705-786 is sufficient to cause a gel-shift. This fragment is within the N-terminal region of Xp95's PRD (N-PRD). Second, we purified phosphorylated Xp95 and by mass spectrometry found that a 5080 Da peptide which maps to N-PRD (amino acids 706-756) contains two phosphorylation sites, one of which is T745, within the conserved CIN85 binding motif. By in vitro protein interaction assays, we that T745 is critical for CIN85/Xp95 interaction, and that Xp95 phosphorylation correlates with loss of binding to CIN85. We also show that an Alix fragment (amino acids 604-789) also undergoes a gel-shift during oocyte maturation and during colcemid-induced mitotic arrest of HeLa cells. These findings indicate that Xp95/Alix is phosphorylated on the PRD during M phase induction and that the PRD phosphorylation regulates partner protein interaction. ^

Novel molecular insights into human tooth agenesis

The development of dentition is a fascinating process that involves a complex series of epithelial-mesenchymel signaling interactions. That such a precise process frequently goes awry is not surprising. Indeed, tooth agenesis is one of the most commonly inherited disorders in humans that affects up to twenty percent of the population and imposes significant functional, emotional and financial burdens on patients. Mutations in the paired box domain containing transcription factor PAX9 result in autosomal dominant tooth agenesis that primarily involves posterior dentition. Despite these advances, little is known about how PAX9 mediates key signaling actions in tooth development and how aberrations in PAX9 functions lead to tooth agenesis. As an initial step towards providing evidence for the pathogenic role of mutant PAX9 proteins, I performed a series of molecular genetic analyses aimed at resolving the structural and functional defects produced by a number of PAX9 mutations causing non-syndromic posterior tooth agenesis. It is likely that the pathogenic mechanism underlying tooth agenesis for the first two mutations studied (219InsG and IIe87Phe) is haploinsufficiency. For the six paired domain missense mutations studied, the lack of functional defects observed for three of the mutant proteins suggests that these mutations altered PAX9 function through alternate mechanisms. Next, I explored further the nature of the partnership between Pax9 and the Msx1 homeoprotein and their role in the expression of a downstream effector molecule, Bmp4. When viewed in the context of events occurring in dental mesenchyme, the results of these studies indicate that the Pax9-Msx1 protein interaction involves the localized up-regulation of Bmp4 activity that is mediated by synergistic interactions between the two transcription factors. Importantly, these assays corroborate in vivo data from mouse genetic studies and support reports of Pax9-dependent expression of Bmp4 in dental mesenchyme. Taken together, these results suggest that PAX9 mutations cause an early developmental defect due to an inability to maintain the inductive potential of dental mesenchyme through involvement in a pathway involving Msx1 and Bmp4. ^

Identification of a conserved cluster in the RH domain of GRK critical for activation by GPCRs

One of the most critical aspects of G Protein Coupled Receptors (GPCRs) regulation is their rapid and acute desensitization following agonist stimulation. Phosphorylation of these receptors by GPCR kinases (GRK) is a major mechanism of desensitization. Considerable evidence from studies of rhodopsin kinase and GRK2 suggests there is an allosteric docking site for the receptor distinct from the GRK catalytic site. While the agonist-activated GPCR appears crucial for GRK activation, the molecular details of this interaction remain unclear. Recent studies suggested an important role for the N- and C-termini and domains in the small lobe of the kinase domain in allosteric activation; however, neither the mechanism of action of that site nor the RH domain contributions have been elucidated. To search for the allosteric site, we first indentified evolutionarily conserved sites within the RH and kinase domains presumably deterministic of protein function employing evolutionary trace (ET) methodology and crystal structures of GRK6. Focusing on a conserved cluster centered on helices 3, 9, and 10 in the RH domain, key residues of GRK5 and 6 were targeted for mutagenesis and functional assays. We found that a number of double mutations within helices 3, 9, and 10 and the N-terminus markedly reduced (50–90%) the constitutive phosphorylation of the β-2 Adrenergic Receptor (β2AR) in intact cells and phosphorylation of light-activated rhodopsin (Rho*) in vitro as compared to wild type (WT) GRK5 or 6. Based on these results, we designed peptide mimetics of GRK5 helix 9 both computationally and through chemical modifications with the goal of both confirming the importance of helix 9 and developing a useful inhibitor to disrupt the GPCR-GRK interaction. Several peptides were found to block Rho* phosphorylation by GRK5 including the native helix 9 sequence, Peptide Builder designed-peptide preserving only the key ET residues, and chemically locked helices. Most peptidomimetics showed inhibition of GRK5 activity greater than 80 % with an IC50 of ∼ 30 µM. Alanine scanning of helix 9 has further revealed both essential and non-essential residues for inhibition. Importantly, substitution of Arg 169 by an alanine in the native helix 9-based peptide gave an almost complete inhibition at 30 µM with an IC50 of ∼ 10 µM. In summary we report a previously unrecognized crucial role for the RH domain of GRK5 and 6, and the subsequent identification of a lead peptide inhibitor of protein-protein interaction with potential for specific blockade of GPCR desensitization. ^

Functional Characterization of AtxA, the Bacillus anthracis Virulence Regulator

Coordinated expression of virulence genes in Bacillus anthracis occurs via a multi-faceted signal transduction pathway that is dependent upon the AtxA protein. Intricate control of atxA gene transcription and AtxA protein function have become apparent from studies of AtxA-induced synthesis of the anthrax toxin proteins and the poly-D-glutamic acid capsule, two factors with important roles in B. anthracis pathogenesis. The amino-terminal region of the AtxA protein contains winged-helix (WH) and helix-turn-helix (HTH) motifs, structural features associated with DNA-binding. Using filter binding assays, I determined that AtxA interacted non-specifically at a low nanomolar affinity with a target promoter (Plef) and AtxA-independent promoters. AtxA also contains motifs associated with phosphoenolpyruvate: sugar phosphotransferase system (PTS) regulation. These PTS-regulated domains, PRD1 and PRD2, are within the central amino acid sequence. Specific histidines in the PRDs serve as sites of phosphorylation (H199 and H379). Phosphorylation of H199 increases AtxA activity; whereas, H379 phosphorylation decreases AtxA function. For my dissertation, I hypothesized that AtxA binds target promoters to activate transcription and that DNA-binding activity is regulated via structural changes within the PRDs and a carboxy-terminal EIIB-like motif that are induced by phosphorylation and ligand binding. I determined that AtxA has one large protease-inaccessible domain containing the PRDs and the carboxy-terminal end of the protein. These results suggest that AtxA has a domain that is distinct from the putative DNA-binding region of the protein. My data indicate that AtxA activity is associated with AtxA multimerization. Oligomeric AtxA was detected when co-affinity purification, non-denaturing gel electrophoresis, and bis(maleimido)hexane (BMH) cross-linking techniques were employed. I exploited the specificity of BMH for cysteine residues to show that AtxA was cross-linked at C402, implicating the carboxy-terminal EIIB-like region in protein-protein interactions. In addition, higher amounts of the cross-linked dimeric form of AtxA were observed when cells were cultured in conditions that promote toxin gene expression. Based on the results, I propose that AtxA multimerization requires the EIIB-like motif and multimerization of AtxA positively impacts function. I investigated the role of the PTS in the function of AtxA and the impact of phosphomimetic residues on AtxA multimerization. B. anthracis Enzyme I (EI) and HPr did not facilitate phosphorylation of AtxA in vitro. Moreover, markerless deletion of ptsHI in B. anthracis did not perturb AtxA function. Taken together, these results suggest that proteins other than the PTS phosphorylate AtxA. Point mutations mimicking phosphohistidine (H to D) and non-phosphorylated histidine (H to A) were tested for an impact on AtxA activity and multimerization. AtxA H199D, AtxA H199A, and AtxA H379A displayed multimerization phenotypes similar to that of the native protein, whereas AtxA H379D was not susceptible to BMH cross-linking or co-affinity purification with AtxA-His. These data suggest that phosphorylation of H379 may decrease AtxA activity by preventing AtxA multimerization. Overall, my data support the following model of AtxA function. AtxA binds to target gene promoters in an oligomeric state. AtxA activity is increased in response to the host-related signal bicarbonate/CO2 because this signal enhances AtxA multimerization. In contrast, AtxA activity is decreased by phosphorylation at H379 because multimerization is inhibited. Future studies will address the interplay between bicarbonate/CO2 signaling and phosphorylation on AtxA function.

Targeting TRAF6 for Cancer Therapeutical Development

Tumor necrosis factor (TNF)-Receptor Associated Factors (TRAFs) are a family of signal transducer proteins. TRAF6 is a unique member of this family in that it is involved in not only the TNF superfamily, but the toll-like receptor (TLR)/IL-1R (TIR) superfamily. The formation of the complex consisting of Receptor Activator of Nuclear Factor κ B (RANK), with its ligand (RANKL) results in the recruitment of TRAF6, which activates NF-κB, JNK and MAP kinase pathways. TRAF6 is critical in signaling with leading to release of various growth factors in bone, and promotes osteoclastogenesis. TRAF6 has also been implicated as an oncogene in lung cancer and as a target in multiple myeloma. In the hopes of developing small molecule inhibitors of the TRAF6-RANK interaction, multiple steps were carried out. Computational prediction of hot spot residues on the protein-protein interaction of TRAF6 and RANK were examined. Three methods were used: Robetta, KFC2, and HotPoint, each of which uses a different methodology to determine if a residue is a hot spot. These hot spot predictions were considered the basis for resolving the binding site for in silico high-throughput screening using GOLD and the MyriaScreen database of drug/lead-like compounds. Computationally intensive molecular dynamics simulations highlighted the binding mechanism and TRAF6 structural changes upon hit binding. Compounds identified as hits were verified using a GST-pull down assay, comparing inhibition to a RANK decoy peptide. Since many drugs fail due to lack of efficacy and toxicity, predictive models for the evaluation of the LD50 and bioavailability of our TRAF6 hits, and these models can be used towards other drugs and small molecule therapeutics as well. Datasets of compounds and their corresponding bioavailability and LD50 values were curated based, and QSAR models were built using molecular descriptors of these compounds using the k-nearest neighbor (k-NN) method, and quality of these models were cross-validated.

Network-based analysis of genome-wide scans of natural selection

The genomic era brought by recent advances in the next-generation sequencing technology makes the genome-wide scans of natural selection a reality. Currently, almost all the statistical tests and analytical methods for identifying genes under selection was performed on the individual gene basis. Although these methods have the power of identifying gene subject to strong selection, they have limited power in discovering genes targeted by moderate or weak selection forces, which are crucial for understanding the molecular mechanisms of complex phenotypes and diseases. Recent availability and rapid completeness of many gene network and protein-protein interaction databases accompanying the genomic era open the avenues of exploring the possibility of enhancing the power of discovering genes under natural selection. The aim of the thesis is to explore and develop normal mixture model based methods for leveraging gene network information to enhance the power of natural selection target gene discovery. The results show that the developed statistical method, which combines the posterior log odds of the standard normal mixture model and the Guilt-By-Association score of the gene network in a naïve Bayes framework, has the power to discover moderate/weak selection gene which bridges the genes under strong selection and it helps our understanding the biology under complex diseases and related natural selection phenotypes.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

A novel DNA damage inducible inhibitor of p53

p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^

Analysis of Agrobacterium tumefaciens VirB6 and VirB9 of the VirB /D4 type IV secretion system

Agrobacterium tumefaciens uses the VirB/D4 type IV secretion system (T4SS) to translocate oncogenic DNA (T-DNA) and protein substrates to plant cells. Independent of VirD4, the eleven VirB proteins are also essential for elaboration of a conjugative pilus termed the T pilus. The focus of this thesis is the characterization and analysis of two VirB proteins, VirB6 and VirB9, with respect to substrate translocation and T pilus biogenesis. Observed stabilizing effects of VirB6 on other VirB subunits and results of protein-protein interaction studies suggest that VirB6 mediates assembly of the secretion machine and T pilus through interactions with VirB7 and VirB9. Topology studies support a model for VirB6 as a polytopic membrane protein with a periplasmic N terminus, a large internal periplasmic loop, five transmembrane segments, and a cytoplasmic C terminus. Topology studies and Transfer DNA immunoprecipitation (TrIP) assays identified several important VirB6 functional domains: (i) the large internal periplasmic loop mediates interaction of VirB6 with the T-DNA, (ii) the membrane spanning region carboxyl-terminal to the large periplasmic loop mediates substrate transfer from VirB6 to VirB8, and (iii) the terminal regions of VirB6 are required for substrate transfer to VirB2 and VirB9. To analyze structure-function relationships of VirB9, the phenotypic consequences of dipeptide insertion mutations were characterized. Substrate discriminating mutations were shown to selectively export the oncogenic T-DNA and VirE2 to plant cells or a mobilizable IncQ plasmid to bacterial cells. Mutations affecting VirB9 interactions with VirB7 and VirB10 were localized to the C- and N- terminal regions respectively. Additionally, “uncoupling” mutations identified in VirB11 and VirB6 that block T pilus assembly, but not substrate transfer to recipient cells, were also identified in VirB9. These results in conjunction with computer analysis establish that VirB9, like VirB6, is also composed of distinct regions or domains that contribute in various ways to secretion channel activity and T pilus assembly. Lastly, in vivo immunofluorescent studies suggest that VirB9 localizes to the outer membrane and may play a role similar to that of secretion/ushers of types II and III secretion systems to facilitate substrate translocation across this final bacterial barrier. ^

Dissecting the Interaction between p53 and TRIM24

Dissecting the Interaction of p53 and TRIM24 Aundrietta DeVan Duncan Supervisory Professor, Michelle Barton, Ph.D. p53, the “guardian of the genome”, plays an important role in multiple biological processes including cell cycle, angiogenesis, DNA repair and apoptosis. Because it is mutated in over 50% of cancers, p53 has been widely studied in established cancer cell lines. However, little is known about the function of p53 in a normal cell. We focused on characterizing p53 in normal cells and during differentiation. Our lab recently identified a novel binding partner of p53, Tripartite Motif 24 protein (TRIM24). TRIM24 is a member of the TRIM family of proteins, defined by their conserved RING, B-box, and coiled coil domains. Specifically, TRIM24 is a member of the TIF1 subfamily, which is characterized by PHD and Bromo domains in the C-terminus. Between the Coiled-coil and PHD domain is a linker region, 437 amino acids in length. This linker region houses important functions of TRIM24 including it’s site of interaction with nuclear receptors. TRIM24 is an E3-ubiquitin ligase, recently discovered to negatively regulate p53 by targeting it for degradation. Though it is known that Trim24 and p53 interact, it is not known if the interaction is direct and what effect this interaction has on the function of TRIM24 and p53. My study aims to elucidate the specific interaction domains of p53 and TRIM24. To determine the specific domains of p53 required for interaction with TRIM24, we performed co-immuoprecipitation (Co-IP) with recombinant full-length Flag-tagged TRIM24 protein and various deletion constructs of in vitro translated GST-p53, as well as the reverse. I found that TRIM24 binds both the carboxy terminus and DNA binding domain of p53. Furthermore, my results show that binding is altered when post-translational modifications of p53 are present, suggesting that the interaction between p53 and TRIM24 may be affected by these post-translational modifications. To determine the specific domains of TRIM24 required for p53 interaction, we performed GST pull-downs with in vitro translated, Flag-TRIM24 protein constructs and recombinant GST-p53 protein purified from E. coli. We found that the Linker region is sufficient for interaction of p53 and TRIM24. Taken together, these data indicate that the interaction between p53 and TRIM24 does occur in vitro and that interaction may be influenced by post-translational modifications of the proteins.

INTERACTION OF BACILLUS ANTHRACIS EXOSPORIUM PROTEIN BCLA WITH COMPLEMENT FACTOR H AND SPORE PERSISTENCE IN THE LUNG

Anthrax outbreaks in the United States and Europe and its potential use as a bioweapon have made Bacillus anthracis an interest of study. Anthrax infections are caused by the entry of B. anthracis spores into the host via the respiratory system, the gastrointestinal tract, cuts or wounds in the skin, and injection. Among these four forms, inhalational anthrax has the highest lethality rate and persistence of spores in the lungs of animals following pulmonary exposure has been noted for decades. However, details or mechanisms of spore persistence were not known. In this study, we investigated spore persistence in a mouse model. The results suggest that B. anthracis spores have special properties that promote persistence in the lung, and that there may be multiple mechanisms contributing to spore persistence. Moreover, recent discoveries from our laboratory suggest that spores evolved a sophisticated mechanism to interact with the host complement system. The complement system is a crucial part of the host defense mechanism against foreign microorganisms. Knowledge of the specific interactions that occur between the complement system and B. anthracis was limited. Studies performed in our laboratory have suggested that spores of B. anthracis can target specific proteins, such as Factor H (fH) of the complement system. Spores of B. anthracis are enclosed by an exosporium, which consists of a basal layer surrounded by a nap of hair-like filaments. The major structural component of the filaments is called Bacillus collagen-like protein of anthracis (BclA), which comprises a central collagen-like region and a globular C-terminal domain. BclA is the first point of contact with the innate system of an infected host. In this study, we investigated the molecular details of BclA-fH interaction with respect to the specific binding mechanism and the functional significance of this interaction in a murine model of anthrax infection. We hypothesized that the recruitment of fH to the spore surface by BclA limits the extent of complement activation and promotes pathogen survival and persistence in the infected host. Findings from this study are significant to understanding how to treat post-exposure prophylaxis and improve our knowledge of spores with the host immune system.

THE MOLECULAR INTERACTION BETWEEN TYPE II DIABETES AND ALZHEIMER’S DISEASE THROUGH CROSS-SEEDING OF PROTEIN MISFOLDING

With the population of the world aging, the prominence of diseases such as Type II Diabetes (T2D) and Alzheimer’s disease (AD) are on the rise. In addition, patients with T2D have an increased risk of developing AD compared to age-matched individuals, and the number of AD patients with T2D is higher than among aged-matched non-AD patients. AD is a chronic and progressive dementia characterized by amyloid-beta (Aβ) plaques, neurofibrillary tangles (NFTs), neuronal loss, brain inflammation, and cognitive impairment. T2D involves the dysfunctional use of pancreatic insulin by the body resulting in insulin resistance, hyperglycemia, hyperinsulinemia, pancreatic beta cell (β-cell) death, and other complications. T2D and AD are considered protein misfolding disorders (PMDs). PMDs are characterized by the presence of misfolded protein aggregates, such as in T2D pancreas (islet amyloid polypeptide - IAPP) and in AD brain (amyloid– Aβ) of affected individuals. The misfolding and accumulation of these proteins follows a seeding-nucleation model where misfolded soluble oligomers act as nuclei to propagate misfolding by recruiting other native proteins. Cross-seeding occurs when oligomers composed by one protein seed the aggregation of a different protein. Our hypothesis is that the pathological interactions between T2D and AD may in part occur through cross-seeding of protein misfolding. To test this hypothesis, we examined how each respective aggregate (Aβ or IAPP) affects the disparate disease pathology through in vitro and in vivo studies. Assaying Aβ aggregates influence on T2D pathology, IAPP+/+/APPSwe+/- double transgenic (DTg) mice exhibited exacerbated T2D-like pathology as seen in elevated hyperglycemia compared to controls; in addition, IAPP levels in the pancreas are highest compared to controls. Moreover, IAPP+/+/APPSwe+/- animals demonstrate abundant plaque formation and greater plaque density in cortical and hippocampal areas in comparison to controls. Indeed, IAPP+/+/APPSwe+/- exhibit a colocalization of both misfolded proteins in cerebral plaques suggesting IAPP may directly interact with Aβ and aggravate AD pathology. In conclusion, these studies suggest that cross-seeding between IAPP and Aβ may occur, and that these protein aggregates exacerbate and accelerate disease pathology, respectively. Further mechanistic studies are necessary to determine how these two proteins interact and aggravate both pancreatic and brain pathologies.