18 resultados para Positive-negative Asymmetry


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The management of HIV infection with antiretroviral drugs has succeeded in increasing survival rates, but the subject of pregnancy in HIV-positive women continues to garner debate. Discrimination and stigma have been identified as barriers to health care, suggesting that women with HIV may be disinclined to seek prenatal care if health-care workers exhibit negative attitudes toward the women's pregnancies. To optimize prenatal and medical care for women with HIV infection, it is important to understand the general social conditions and cultural context in which these women have children. Goffman's treatise on stigma, Foucault's discussion of the knowledge/power matrix, and Bandura's Social Cognitive Theory offer theoretical perspectives by which we can evaluate the gender, race, and class issues that are inherent in pregnancy decision-making for women with HIV infection. It is also necessary to evaluate prevailing attitudes on childbearing toward HIV-positive women and to review the historical background of prejudice in which HIV-positive women make decisions regarding childbearing. ^ This qualitative study used a survey instrument and one-on-one interviews with HIV-infected women to elicit their perceptions of how they were treated by care providers when they became pregnant. It also included interviews with health-care workers to determine what their feelings are about pregnancy within the context of HIV infection. Results of the ethnographic inquiry reveal that most of the women had negative experiences at some point during a pregnancy, but that the situation improved when they sought care from a provider who was familiar with HIV infection. The health-care providers interviewed were firm in their belief that HIV-positive women deserved optimal care and treated the women with respect, but these are individuals who are also experts in providing care to HIV-positive patients. The question remains as to what kind of care HIV-positive women are receiving generally and what types of attitudes they are being subjected to if they see less experienced providers. Further research is also needed to determine whether HIV-positive women from a broader ethnic representation and higher socioeconomic status experience similar negative attitudes. ^