Comparison of health behaviors of Mexican American and non -Hispanic White females: Implications for health promotion programs

Hispanics form the second-largest minority group in the United States totaling 22 million people. Health data on this population are sparse and inconsistent. This study seeks to determine use of preventative services and risk factor behaviors of Mexican American and non-Hispanic White females residing in South Texas.^ Baseline data from female respondents in household surveys in six South Texas counties (Ramirez and McAlister, 1988; McAlister et al., 1992) were analyzed to test the following hypotheses: (1) Mexican American and Non-Hispanic White females exhibit different patterns of health behaviors; (2) Mexican American females will exhibit different health behaviors regardless of age; and (3) the differences between Mexican American women and non-Hispanic White females are due to education and acculturation factors.^ Over the past decade, the traditional behaviors of Mexican American females have begun to change due to education, acculturation, and their participation in the labor force. The results from this study identify some of the changes that will require immediate attention from health care providers. Results revealed that regardless of ethnicity, age, education, and language preference, non-Hispanic White females were significantly more likely to participate in preventive screening practices than were Mexican American females. Risk factor analysis revealed a different pattern with Mexican American females significantly more likely to be non-smokers, non-alcoholic drinkers, and to have good fat avoidance practices compared to non-Hispanic White females. However, compared to those who are less-educated or Spanish-speaking, Mexican American females with higher levels of education and preference for speaking English only showed positive and negative health behaviors that were more similar to the non-Hispanic White females. The positive health behaviors that come with acculturation, e.g., more participation in preventive care and more physical activity, are welcome changes. But this study has implications for global health development and reinforces a need for "primordial" prevention strategies to deter the unwanted concomitants of economic development and acculturation. Smoking and drinking behaviors among Mexican American females need to be kept at low levels to prevent increased morbidity and premature deaths in this population. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Behavioral decision making and the levels of change: An application of the transtheoretical model to prenatal smoking in low -income women

Despite continued research and public health efforts to reduce smoking during pregnancy, prenatal cessation rates in the United States have decreased and the incidence of low birth weight has increased from 1985 to 1991. Lower socioeconomic status women who are at increased risk for poor pregnancy outcomes may be resistant to current intervention efforts during pregnancy. The purpose of this dissertation was to investigate the determinants of continued smoking and quitting among low-income pregnant women.^ Using data from cross-sectional surveys of 323 low-income pregnant smokers, the first study developed and tested measures of the pros and cons of smoking during pregnancy. The original decisional balance measure for smoking was compared with a new measure that added items thought to be more salient to the target population. Confirmatory factor analysis using structural equation modeling showed neither the original nor new measure fit the data adequately. Using behavioral science theory, content from interviews with the population, and statistical evidence, two 7-item scales representing the pros and cons were developed from a portion (n = 215) of the sample and successfully cross-validated on the remainder of the sample (n = 108). Logistic regression found only pros were significantly associated with continued smoking. In a discriminant function analysis, stage of change was significantly associated with pros and cons of smoking.^ The second study examined the structural relationships between psychosocial constructs representing some of the levels of and the pros and cons of smoking. The cross-sectional design mandates that statements made regarding prediction do not prove causation or directionality from the data or methods analysis. Structural equation modeling found the following: more stressors and family criticism were significantly more predictive of negative affect than social support; a bi-directional relationship was found between negative affect and current nicotine addiction; and negative affect, addiction, stressors, and family criticism were significant predictors of pros of smoking.^ The findings imply reversing the trend of decreasing smoking cessation during pregnancy may require supplementing current interventions for this population of pregnant smokers with programs addressing nicotine addiction, negative affect, and other psychosocial factors such as family functioning and stressors. ^

Subjective well -being as predictor of mortality, heart disease, and obesity: Prospective evidence from the Alameda County Study

Based on the World Health Organization's (1965) definition of health, understanding of health requires understanding of positive psychological states. Subjective Well-being (SWB) is a major indicator of positive psychological states. Up to date, most studies of SWB have been focused on its distributions and determinants. However, study of its consequences, especially health consequences, is lacking. This dissertation research examined Subjective Well-being, as operationally defined by constructs drawn from the framework of Positive Psychology, and its sub-scores (Positive Feelings and Negative Feelings) as predictors of three major health outcomes—mortality, heart disease, and obesity. The research used prospective data from the Alameda County Study over 29 years (1965–1994), based on a stratified, randomized, representative sample of the general public in Alameda County, California (Baseline N = 6928). ^ Multivariate analyses (Survival analyses using sequential Cox Proportional Hazard models in the cases of mortality and heart disease, and sequential Logistic Regression analyses in the case of obesity) were performed as the main methods to evaluate the associations of the predictors and the health outcomes. The results revealed that SWB reduced risks of all-cause mortality, natural-cause mortality, and cardiovascular mortality. Positive feelings not only had an even stronger protective effect against all-cause, natural-cause and cardiovascular mortality, but also predicted decreased unnatural-cause mortality which includes deaths from suicide, homicide, accidents, mental disorders, drug dependency, as well as alcohol-related liver diseases. These effects were significant even after adjusted for age, gender, education, and various physical health measures, and, in the case of cardiovascular mortality, obesity and health practices (alcohol consumption, smoking, and physical activities). However, these two positive psychological indicators, SWB and positive feelings, did not predict obesity. And negative feelings had no significant effect on any of the health outcomes evaluated, i.e., all-cause mortality, natural- and unnatural-cause mortality, cardiovascular mortality, or obesity, after covariates were controlled. These findings were discussed (1) in comparison with relevant existing studies, (2) in terms of their implications in health research and promotion, (3) in terms of the independence of positive and negative feelings, and (4) from a Positive Psychology perspective and its significance in Public Health research and practice. ^