27 resultados para Positive affectivity and negative affectivity


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Although the association between syphilis infection status and compliance with the hepatitis B virus vaccine has been the focus of investigation, there is a lack of data regarding the association between syphilis infection and HBV vaccine compliance. The author investigated the association between the exposure of syphilis infection and the outcome of HBV vaccine completion, defined as degree of constancy and accuracy with which a patient follows a prescribed regimen. A cohort design was employed using interview and serological data from the Drugs, AIDS, STDs, Hepatitis (DASH) Research Project; analysis was restricted to HIV and HBV seronegative (at baseline), illicit drug users residing in Harris County. Syphilis negative and syphilis positive infection status was determined from the serological data while covariates and outcome information were determined from the DASH Project Questionnaire; enrolled subjects (n=1160) were selected from the data. Association between exposure and outcome was assessed with logistic regression adjusted for data-based confounders. ^ A prevalence of 7% and 71% was found for syphilis and HBV vaccine compliance, respectively. When measuring the actual association between syphilis infection status and HBV vaccine compliance, an odds ratio of 1.49 (95% CI: 0.86, 2.72) was obtained. There was a non-significant association between these two variables. 78% of the study population was syphilis positive and completed the vaccine series compared to 70% of the population that was syphilis negative and received all three doses. This finding confirms that there is a difference between syphilis positive and negative drug users with respect to HBV vaccine compliance. The fact that differences were found in these drug users with respect to vaccine schedule supports the idea that sub-group differences may exist and thus merits further investigation. If these differences are confirmed, it is recommended that STI interventions identify community characteristics of their samples and target populations based on practices specific to that community. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study is designed to be a cross-sectional, retrospective analysis of the seroprevalence of anti-WNV antibodies in 1,006 plasma samples collected from February 2, 2006 to June 18, 2007 originally for The Cameron County Hispanic Cohort: Extreme obesity and uncontrolled diabetes on the U.S.-Mexico border, major concerns for populations with health disparities. The aim of this thesis research is to give a more up-to-date picture of Flavivirus activity in south Texas, which can potentially contribute to the surveillance objective of arboviral control in this area. A West Nile virus (WNV) seroprevalence study in humans in this particular area has never before been completed. Plasma samples were tested using immunoglobulin-G (IgG) and immunoglobulin-M (IgM) WNV enzyme linked immunosorbent assays (ELISA). Estimated seroprevalence for this particular population was 0.98% or 9.8 cases of West Nile disease per 1,000 citizens. After IgG testing, seroprevalence in the study population was found to be 15.4%. Specimens tested for WNV IgG were compared with a subset of specimens (N=803) tested for history of primary dengue virus (DENV) infection. Of the 803 specimens tested for IgG to DENV, 308 were positive. Of the 132 positive WNV IgG specimens in the subset, 131 (99.2%) tested also tested positive for DENV IgG. It would be helpful to use standard plaque reduction neutralization testing to determine if the seroprevalence is in fact lower because of cross-reaction to DENV on testing. Regardless of the possibility of other Flavivirus activity occurring prior to the introduction of WNV into the United States and the potential for cross-reactivity, Texas has ranked in the top 5 states with the highest, laboratory confirmed incidence of infection with WNV since 2003. Indicating that climate factors and the presence of suitable vectors makes Texas a hotspot for WNV activity. ^ A description of the study population by age, gender, and income was done indicating a statistically significant income difference with a mean household income per year being $13,413.55 for a case and $20,268.80 for non-cases (p=0.001). Lower income neighborhoods should be targeted for education and prevention of vector-borne diseases during the summer months in Cameron County. With respect to gender, being male has been noted in the literature to be a risk factor for infection with WNV (25). In this study, females comprised approximately 68% of the study population, they also made up 66.5% of the positive IgG specimens. An odds ratio of 0.91 indicates that women are less likely to be IgG positive for WNV as compared to men; however, this was not found to be significant based on the 95% confidence interval, but is consistent with the literature. When looking at age difference between positive and negative/equivocal cases, there was no statistical difference found between the two groups. ^ We concluded that this study will enable us to understand the epidemiology of WNV transmission since its introduction into the United States and hopefully to maintain or improve the current measures we have in place to prevent infections that are seen annually with WNV.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Obesity has a complex, multi-factorial etiology. Infectious agents have recently emerged as a possible contributor to the current obesity epidemic. Seven viruses have demonstrated an association with obesity in animals; however, Adenovirus-36 (Ad-36) is the only known virus associated with obesity in humans. The primary aim of this research was to determine the association between Ad-36 infection and the expression of obesity related hormones in children. Additionally, this study proposed to compare the mean three year change in the level of obesity related hormones between Ad-36 positive and negative children. This study utilized pilot data collected from 98 children at baseline and year three of the Project Heartbeat! cohort. Fasting serum samples were analyzed for the concentration of adiponectin, insulin and leptin. The crude analysis uncovered Ad-36 positive children had significantly lower mean concentrations of insulin (p=0.039) and leptin (p=0.038) at baseline compared to Ad-36 negative children. The results of the adjusted analysis indicated the leptin association with Ad-36 infection at baseline was statistically significant even after controlling for age, sex, ethnicity, and BMI percentile. The longitudinal evaluation revealed individuals with a history of Ad-36 infection experienced a larger mean decrease in adiponectin, a larger mean increase in leptin, and a smaller mean increase in insulin levels over a three year period compared to individuals without a history of infection. These results suggest Ad-36 infection may produce changes in hormone expression. The only statistically significant findings in the crude and adjusted longitudinal analysis occurred at baseline when the children were younger, suggesting physical changes that occur during sexual maturation may mask or enhance Ad-36 induced changes in hormone expression. Furthermore, the longitudinal analysis revealed the duration and course of Ad-36 infection may influence changes in the expression of obesity-related hormones. Taken together, the results of this pilot study are suggestive of an association between Ad-36 infection and the expression of obesity-related hormones.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background. Inhibition of tumor necrosis factor (TNF) is associated with progression of latent tuberculosis infection (LTBI) to active disease. LTBI screening prior to starting TNF inhibitor therapy is recommended. Blood tests, collectively known as interferon-gamma release assays (IGRAs), offer a means other than the tuberculin skin test (TST) of screening for LTBI. However, in the setting of immune compromise, anergy may limit the clinical utility of IGRAs. ^ Methods. A cross-sectional study was conducted in children and young adults ≤ 21 years of age who were cared for at Texas Children's Hospital in Houston, TX, during 2011 and who were candidates for, or were receiving, tumor necrosis factor (TNF)-inhibitor therapy. All subjects answered a risk factor questionnaire and were tested for LTBI by two commercially available IGRAs (QuantiFERON-Gold In-Tube assay and the T-SPOT.TB assay), along with the TST. T-cell phenotypes were evaluated through flow cytometry, both at baseline and after antigen stimulation. ^ Results. Twenty-eight subjects were enrolled. All were TST negative and none were IGRA positive. Results were negative for the 27 subjects who were tested with QuantiFERON-Gold In-Tube. However, 26% of subjects demonstrated anergy in the T-SPOT.T. Patients with T-SPOT. TB anergy had lower quantitative IFN-γ responses to mitogen in the QFT assay—the mean IFN-γ level to mitogen in patients without T-SPOT.TB anergy was 9.84 IU/ml compared to 6.91 IU/ml in patients with T-SPOT.TB anergy (P = 0.046). Age and use of TNF inhibitors, corticosteroids, or methotrexate use were not significantly associated with T-SPOT.TB anergy. Antigen stimulation revealed depressed expression of intracellular IFN-γ in subjects with T-SPOT. TB anergy. ^ Conclusions. The frequency of anergy in this population is higher than would be expected from studies in adults. There appears to be inappropriate IFN-γ responses to antigen in subjects with T-SPOT. TB anergy. This immune defect was detected by the T-SPOT. TB assay but not by the QuantiFERON-Gold In-Tube assay. Further data are needed to clarify the utility of IGRAs in this population.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The prevalence of obesity has continued to rise over the last several decades in the United States lending to overall increases in risk for chronic diseases including many types of cancer. In contrast, reduction in energy consumption via calorie restriction (CR) has been shown to be a potent inhibitor of carcinogenesis across a broad range of species and tumor types. Previous data has demonstrated differential signaling through Akt and mTOR via the IGF-1R and other growth factor receptors across the diet-induced obesity (DIO)/CR spectrum. Furthermore, mTORC1 is known to be regulated directly via nutrient availability, supporting its role in the link between epithelial carcinogenesis and diet-induced obesity. In an effort to better understand the importance of mTORC1 in the context of both positive and negative energy balance during epithelial carcinogenesis, we have employed the use of specific pharmacological inhibitors, rapamycin (mTORC1 inhibitor) and metformin (AMPK activator) to target mTORC1 or various components of this pathway during skin tumor promotion. Two-stage skin carcinogenesis studies demonstrated that mTORC1 inhibition via rapamycin, metformin or combination treatments greatly inhibited skin tumor development in normal, overweight and obese mice. Furthermore, mechanisms by which these chemopreventive agents may be exerting their anti-tumor effects were explored. In addition, the effect of these compounds on the epidermal proliferative response was analyzed and drastic decreases in epidermal hyperproliferation and hyperplasia were found. Rapamycin also inhibited dermal inflammatory cell infiltration in a dose-dependent manner. Both compounds also blocked or attenuated TPA-induced signaling through epidermal mTORC1 as well as several downstream targets. In addition, inhibition of this pathway by metformin appeared to be, at least in part, dependent on AMPK activation in the skin. Overall, the data indicate that pharmacological strategies targeting this pathway offset the tumor-enhancing effects of DIO and may serve as possible CR mimetics. They suggest that mTORC1 contributes significantly to the process of skin tumor promotion, specifically during dietary energy balance effects. Exploiting the mechanistic information underlying dietary energy balance responsive pathways will help translate decades of research into effective strategies for prevention of epithelial carcinogenesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Personnel involved in natural or man-made disaster response and recovery efforts may be exposed to a wide variety of physical and mental stressors that can exhibit long-lasting and detrimental psychopathological outcomes. In a disaster situation, huge numbers of "secondary" responders can be involved in contaminant clean-up and debris removal and can be at risk of developing stress-related mental health outcomes. The Occupational Safety and Health Administration (OSHA) worker training hierarchy typically required for response workers, known as "Hazardous Waste Operations and Emergency Response" (HAZWOPER), does not address the mental health and safety concerns of workers. This study focused on the prevalence of traumatic stress experienced by secondary responders that had received or expressed interest in receiving HAZWOPER training through the National Institute of Environmental Health Sciences Worker Education and Training Program (NIEHS WETP). ^ The study involved the modification of two preexisting and validated survey tools to assess secondary responder awareness of physical, mental, and traumatic stressors on mental health and sought to determine if a need existed to include traumatic stress-related mental health education in the current HAZWOPER training regimen. The study evaluated post-traumatic stress disorder (PTSD), resiliency, mental distress, and negative effects within a secondary responder population of 176 respondents. Elevated PTSD levels were seen in the study population as compared to a general responder population (32.9% positive vs. 8%-22.5% positive). Results indicated that HAZWOPER-trained disaster responders were likely to test positive for PTSD, whereas, untrained responders with no disaster experience and responders who possessed either training or disaster experience only were likely to test PTSD negative. A majority (68.75%) of the population tested below the mean resiliency to cope score (80.4) of the average worker population. Results indicated that those who were trained only or who possessed both training and disaster work experience were more likely to have lower resiliency scores than those with no training or experience. There were direct correlations between being PTSD positive and having worked at a disaster site and experiencing mental distress and negative effects. However, HAZWOPER training status does not significantly correlate with mental distress or negative effect. ^ The survey indicated clear support (91% of respondents) for mental health education. The development of a pre- and post-deployment training module is recommended. Such training could provide responders with the necessary knowledge and skills to recognize the symptomology of PTSD, mental stressors, and physical and traumatic stressors, thus empowering them to employ protective strategies or seek professional help if needed. It is further recommended that pre-deployment mental health education be included in the current HAZWOPER 24- and 40-hour course curriculums, as well as, consideration be given towards integrating a stand-alone post-deployment mental health education training course into the current HAZWOPER hierarchy.^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hispanics form the second-largest minority group in the United States totaling 22 million people. Health data on this population are sparse and inconsistent. This study seeks to determine use of preventative services and risk factor behaviors of Mexican American and non-Hispanic White females residing in South Texas.^ Baseline data from female respondents in household surveys in six South Texas counties (Ramirez and McAlister, 1988; McAlister et al., 1992) were analyzed to test the following hypotheses: (1) Mexican American and Non-Hispanic White females exhibit different patterns of health behaviors; (2) Mexican American females will exhibit different health behaviors regardless of age; and (3) the differences between Mexican American women and non-Hispanic White females are due to education and acculturation factors.^ Over the past decade, the traditional behaviors of Mexican American females have begun to change due to education, acculturation, and their participation in the labor force. The results from this study identify some of the changes that will require immediate attention from health care providers. Results revealed that regardless of ethnicity, age, education, and language preference, non-Hispanic White females were significantly more likely to participate in preventive screening practices than were Mexican American females. Risk factor analysis revealed a different pattern with Mexican American females significantly more likely to be non-smokers, non-alcoholic drinkers, and to have good fat avoidance practices compared to non-Hispanic White females. However, compared to those who are less-educated or Spanish-speaking, Mexican American females with higher levels of education and preference for speaking English only showed positive and negative health behaviors that were more similar to the non-Hispanic White females. The positive health behaviors that come with acculturation, e.g., more participation in preventive care and more physical activity, are welcome changes. But this study has implications for global health development and reinforces a need for "primordial" prevention strategies to deter the unwanted concomitants of economic development and acculturation. Smoking and drinking behaviors among Mexican American females need to be kept at low levels to prevent increased morbidity and premature deaths in this population. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To identify more mutations that can affect the early development of Myxococcus xanthus, the synthetic transposon TnT41 was designed and constructed. By virtue of its special features, it can greatly facilitate the processes of mutation screening/selection, mapping, cloning and DNA sequencing. In addition, it allows for the systematic discovery of genes in regulatory hierarchies using their target promoters. In this study, the minimal regulatory region of the early developmentally regulated gene 4521 was used as a reporter in the TnT41 mutagenesis. Both positive (P) mutations and negative (N) mutations were isolated based on their effects on 4521 expression.^ Four of these mutations, i.e. N1, N2, P52 and P54 were analyzed in detail. Mutations N1 and N2 are insertion mutations in a gene designated sasB. The sasB gene is also identified in this study by genetic and molecular analysis of five UV-generated 4521 suppressor mutations. The sasB gene encodes a protein without meaningful homology in the databases. The sasB gene negatively regulates 4521 expression possibly through the SasS-SasR two component system. A wild-type sasB gene is required for normal M. xanthus fruiting body formation and sporulation.^ Cloning and sequencing analysis of the P52 mutation led to the identification of an operon that encodes the M. xanthus high-affinity branched-chain amino acid transporter system. This liv operon consists of five genes designated livK, livH, livM, livC, and livF, respectively. The Liv proteins are highly similar to their counterparts from other bacteria in both amino acid sequences, functional motifs and predicted secondary structures. This system is required for development since liv null mutations cause abnormality in fruiting body formation and a 100-fold decrease in sporulation efficiency.^ Mutation P54 is a TnT41 insertion in the sscM gene of the ssc chemotaxis system, which has been independently identified by Dr. Shi's lab. The sscM gene encodes a MCP (methyl-accepting chemotaxis protein) homologue. The SscM protein is predicted to contain two transmembrane domains, a signaling domain and at least one putative methylation site. Null mutations of this gene abolish the aggregation of starving cells at a very early stage, though the sporulation levels of the mutant can reach 10% that of wild-type cells. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The management of HIV infection with antiretroviral drugs has succeeded in increasing survival rates, but the subject of pregnancy in HIV-positive women continues to garner debate. Discrimination and stigma have been identified as barriers to health care, suggesting that women with HIV may be disinclined to seek prenatal care if health-care workers exhibit negative attitudes toward the women's pregnancies. To optimize prenatal and medical care for women with HIV infection, it is important to understand the general social conditions and cultural context in which these women have children. Goffman's treatise on stigma, Foucault's discussion of the knowledge/power matrix, and Bandura's Social Cognitive Theory offer theoretical perspectives by which we can evaluate the gender, race, and class issues that are inherent in pregnancy decision-making for women with HIV infection. It is also necessary to evaluate prevailing attitudes on childbearing toward HIV-positive women and to review the historical background of prejudice in which HIV-positive women make decisions regarding childbearing. ^ This qualitative study used a survey instrument and one-on-one interviews with HIV-infected women to elicit their perceptions of how they were treated by care providers when they became pregnant. It also included interviews with health-care workers to determine what their feelings are about pregnancy within the context of HIV infection. Results of the ethnographic inquiry reveal that most of the women had negative experiences at some point during a pregnancy, but that the situation improved when they sought care from a provider who was familiar with HIV infection. The health-care providers interviewed were firm in their belief that HIV-positive women deserved optimal care and treated the women with respect, but these are individuals who are also experts in providing care to HIV-positive patients. The question remains as to what kind of care HIV-positive women are receiving generally and what types of attitudes they are being subjected to if they see less experienced providers. Further research is also needed to determine whether HIV-positive women from a broader ethnic representation and higher socioeconomic status experience similar negative attitudes. ^