GENETIC ORGANIZATION OF THE STRUCTURAL GENES FOR NITRATE REDUCTASE (TN5)

Nitrate reductase in Escherichia coli is a membrane-bound anaerobic enzyme that is repressed by oxygen and induced by nitrate. The genetic organization of the structural genes for the two larger subunits of nitrate reductase ((alpha) and (beta)) was determined by immunoprecipitation analysis of the formation of these proteins in nitrate reductase-deficient mutants resulting from transposon Tn5 mutagenesis. The results suggested that the genes encoding the (alpha) and (beta) subunits (narG and H) were arranged in an operon with transcription in the direction promoter(--->)(alpha)(--->)(beta). Segments of the chromosome containing the Tn5 inserts from several of the mutants were cloned into plasmid pBR322 and the positions of the transposons determined by restriction mapping. The Tn5 insertion sites were localized on two contiguous EcoRI fragments spanning about 6.6 kilobases of DNA. The narI gene (proposed to encode the (gamma) subunit) was positioned immediately downstream from the (beta)-gene (narH) by Southern analysis of Tn10 insertions into the narI locus. A Tn10 insertion into the narK locus, proposed to encode a nitrate-sensitive repressor of other anaerobic enzymes, was located about 1.5 kilobases upstream from the narGHI operon promoter. The narL locus, proposed to encode a nitrate-sensitive positive regulator of the narGHI operon and known to be genetically linked to the other nar genes, was demonstrated to lie outside a 19.3-kilobase region of the chromosome which encompasses the other nar genes. The physical limit of the narGHI promoter was defined by studying the effect of Tn5 insertions into a hybrid plasmid containing the functional operon. The points of origin of the coding regions for the (alpha) and (beta) genes were deduced by alignment of the chromosomal map of Tn5 insertion sites with the sizes of (alpha) and (beta) subunit fragments produced by plasmids carrying these Tn5 inserts in the nar operon. The coding region for the (alpha) subunit (143,000 daltons) begins about 250 nucleotides downstream from the deduced limit of the promoter region and includes about 4.0 kilobases of DNA; the region encoding (beta) (60,000 daltons) lies immediately downstream from the (alpha)-gene and is approximately 1.6 kilobases in length. The adjacent region encoding the (gamma) subunit (19,000 daltons) is approximately 0.5 kilobase in length. ^

Cytochrome P450 4F isoforms in different species: Identification, gene regulation and putative roles in inflammation

The cytochrome P450 4F subfamily comprises a group of enzymes that metabolize derivatives of arachidonic acid such as prostaglandins, lipoxins leukotrienes and hydroxyeicosatetraenoic acids, which are important mediators involved in the inflammatory response. Therefore, we speculate that CYP4Fs might be able to modulate the extent of the inflammation by controlling of the tissue levels of these inflammatory mediators, especially, leukotriene B4. One way to provide support for this hypothesis is to test whether the expression of CYP4Fs changes under inflammatory conditions, since these changes are required to adjust the levels of inflammatory mediators. ^ A lipopolysacchride (LPS) induced rat inflammation model was used to analyze the expressions of rat CYP4F4 and CYP4F5 in liver and kidney. LPS administration did not change the constitutive expression level of CYP4F4 and CYP4F5. In liver, the expressions of CYP4F4 and CYP4F5 decreased to 50–60% of the untreated level. The same effect of LPS on CYP4F4 and CYP4F5 expression can be mimicked in hepatocyte primary cultures treated with LPS, indicating a direct of effect of LPS on hepatocytes. LPS treatment also decreased the activity of liver microsomes towards chlorpromazine, however, antibody inhibition study revealed that liver CYP4Fs are not the only players in metabolizing chlorpromazine. To study further the underlying mechanism, CYP4F5 gene was isolated, characterized, and the promoter region was defined. ^ Accumulating evidence showed that peroxisome proliferator-activated receptors (PPARs) play an active role in inflammation. To investigate the possible role of PPARα in regulating CYP4F expression by inflammation or by clofibrate treatment, the expressions of two new mouse 4F isoforms were analyzed in PPARα knockout mice upon LPS or clofibrate challenge. A novel induction of CYP4F15 by LPS and clofibrate was observed in kidney, and this effect is totally dependent on the presence of PPARα. Renal CYP4F16 expression was not affected by LPS or clofibrate in both (+/+) and (−/−) mice. In contrast, hepatic expressions of CYP4F15 and CYP4F16 were reduced significantly in (+/+) mice, but much less in (−/−) mice, suggesting that PPARα is partially responsible for this down-regulation. Clofibrate treatment reduced the expression of CYP4F16 in liver, but has no effect on CYP4F15 and PPARα does not have a role in hepatic CYP4F expression regulated by clofibrate. In general, CYP4Fs are regulated in an isoform-, tissue- and species-specific manner. ^ A human CYP4F isoform, CYP4F11, was isolated. The genomic structure was also solved by using database mining and bioinformatics tools. Localization of CYP4F11 to chromosome 19, 16 kb upstream of CYP4F2, suggests that human CYP4F genes may form a cluster on chromosome 19. This novel human 4F is highly expressed in liver, as well as in kidney, heart and skeletal muscle. Further study of the activity and gene regulation on CYP4F11 will provide us more insights into the physiological functions of CYP4F subfamily. ^

Alteration of CEACAM1 gene transcription in prostate cancer cells: The role of AR, Sp2, and HDAC

Cell to cell adhesion molecule (CEACAM1), a type II tumor suppressor, has been found to be down-regulated in prostate cancer cells. The mechanism that causes CEACAM1's down-regulation in tumorigenesis is unknown. Here we show that the transcriptional activity of CEACAM1 is decreased in prostate cancer cells. This decrease is not due to methylation of the CEACAM1's promoter, but rather to the alteration of transcription factors regulating CEACAM1 expression. ^ Since androgen/androgen receptors (AR) are potent regulators of prostate growth and differentiation, their role on CEACAM1 gene transcription was examined. The androgen receptor could directly increase CEACAM1 transcriptional activity in a ligand dependent manner by interacting with an AR consensus element that resides in the CEACAM1 promoter. However, AR binding to the CEACAM1 promoter is not related to the loss of CEACAM1 during prostate cancer progression. ^ Further analysis enabled us to determine the particular region in the CEACAM1 promoter that mediates a decrease in CEACAM1 transcriptional activity in prostate cancer cells. Upon further examination, we found that this CEACAM1 promoter region interacts with the Sp1, Sp2, and Sp3 transcription factors. However, only Sp2 expression was found to increase in prostate cancer cells. Inhibiting Sp2 from binding to the CEACAM1 promoter caused an increase in CEACAM1 transcriptional activity in prostate cancer cells. In addition, over-expressing Sp2 in normal prostate cells resulted in a decrease in CEACAM1 transcriptional activity and endogenous protein expression. These observations suggest that Sp2 is a transcription repressor of CEACAM1. Furthermore, prostate cancer cells treated with trichostatin A (TSA), a specific histone deacetylase (HDAC) inhibitor, activated CEACAM1 transcriptional activity. This implies that HDACs are involved in CEACAM1 transcriptional activity. Mutation of the Sp2 DNA binding region on the CEACAM1 promoter inhibited TSA activation of CEACAM1 transcriptional activity. This indicates that HDACs inhibit CEACAM1 transcriptional activity through Sp2. Base on these results, we propose that Sp2 is critical for down-regulating CEACAM1 expression, and one mechanism by which Sp2 represses CEACAM1 expression is by recruiting HDAC to the CEACAM1 promoter in prostate cancer cells. Collectively, these findings provide novel insights into mechanisms that cause the down-regulation of CEACAM1 expression in prostate cancer cells. ^

Regulation and transcript analysis of the ceroperon responsible for quorum sensing in Rhodobacter sphaeroides 2.4.1

Rhodobacter sphaeroides 2.4.1 is a Gram negative facultative photoheterotrophic bacterium that has been shown to have an N-acyl homoserine lactone-based quorum sensing system called cer for c&barbelow;ommunity e&barbelow;scape r&barbelow;esponse. The cer ORFs are cerR, the transcriptional regulator, cerI, the autoinducer synthase and cerA , whose function is unknown. The autoinducer molecule, 7,8- cis-N-(tetradecenoyl) homoserine lactone, has been characterized. The objective of this study was to identify an environmental stimulus that influences the regulation of cerRAI and, to characterize transcription of the cer operon. ^ A cerR::lacZ transcriptional fusion was made and β-Galactosidase assays were performed in R. sphaeroides 2.4.1 strains, wild type, AP3 (CerI−) and AP4 (CerR−). The cerR::lacZ β-Galactosidase assays were used as an initial survey of the mode of regulation of the Cer system. A cerA::lacZ translational fusion was created and was used to show that cerA can be translated. The presence of 7,8-cis-N-(tetradecenoyl) homoserine lactone was detected from R. sphaeroides strains wild type and AP4 (CerR−) using a lasR::lacZ translational fusion autoinducer bioassay. The cerR::lacZ transcriptional fusion in R. sphaeroides 2.4.1 wild type was tested under different environmental stimuli, such as various carbon sources, oxygen tensions, light intensities and culture media to determine if they influence transcription of the cer ORFs. Although lacZ assay data implicated high light intensity at 100 W/m2 to stimulate cer transcription, quantitative Northern RNA data of the cerR transcript showed that low light intensity at 3 W/m2 is at least one environmental stimulus that induces cer transcription. This finding was supported by DNA microarray analysis. Northern analysis of the cerRAI transcript provided evidence that the cer ORFs are co-transcribed, and that the cer operon contains two additional genes. Bioinformatics was used to identify genes that may be regulated by the Cer system by identifying putative lux box homologue sequences in the presumed promoter region of these genes. Genes that were identified were fliQ, celB and calsymin, all implicated in interacting with plants. Primer extension was used to help localize cis-elements in the promoter region. The cerR::lacZ transcriptional fusion was monitored in a subset of different global DNA binding transcriptional regulator mutant strains of R. sphaeroides 2.4.1. Those regulators involved in maintaining an anaerobic photosynthetic lifestyle appeared to have an effect. Collectively, the data imply that R. sphaeroides 2.4.1 activates the Cer system when grown anaerobic photosynthetically at low light intensity, 3 W/m2, and it may be involved in an interaction with plants. ^

An extracytoplasmic function sigma factor operon regulates Myxococcus xanthus developmental gene expression

Myxococcus xanthus is a Gram-negative soil bacterium that undergoes multicellular development when high-density cells are starved on a solid surface. Expression of the 4445 gene, predicted to encode a periplasmic protein, commences 1.5 h after the initiation of development and requires starvation and high density conditions. Addition of crude or boiled supernatant from starving high-density cells restored 4445 expression to starving low-density cells. Addition of L-threonine or L-isoleucine to starving low-density cells also restored 4445 expression, indicating that the high-density signaling activity present in the supernatant might be composed of extracellular amino acids or small peptides. To investigate the circuitry integrating these starvation and high-density signals, the cis- and trans-acting elements controlling 4445 expression were identified. The 4445 transcription start site was determined by primer extension analysis to be 58 by upstream of the predicted translation start site. The promoter region contained a consensus sequence characteristic of e&barbelow;xtrac&barbelow;ytoplasmic f&barbelow;unction (ECF) sigma factor-dependent promoters, suggesting that 4445 expression might be regulated by an ECF sigma factor-dependent pathway, which are known to respond to envelope stresses. The small size of the minimum regulatory region, identified by 5′-end deletion analysis as being only 66 by upstream of the transcription start site, suggests that RNA polymerase could be the sole direct regulator of 4445 expression. To identify trans-acting negative regulators of 4445 expression, a strain containing a 4445-lacZ was mutagenized using the Himar1-tet transposon. The four transposon insertions characterized mapped to an operon encoding a putative ECF sigma factor, ecfA; an anti-sigma factor, reaA; and a negative regulator, reaB. The reaA and the reaB mutants expressed 4445 during growth and development at levels almost 100-fold higher than wild type, indicating that these genes encode negative regulators. The ecfA mutant expressed 4445-lacZ at basal levels, indicating that ecfA is a positive regulator. High Mg2+ concentrations over-stimulated this ecfA pathway possibly due to the depletion of exopolysaccharides and assembled type IV pili. These data indicate that the ecfA operon encodes a new regulatory stress pathway that integrates and transduces starvation and cell density cues during early development and is also responsive to cell-surface alterations.^

Matrix metalloproteinase-1 as a prognosticator in malignant glioma

The overall purpose of this study was to assess the relationship between the promoter region polymorphism (-2607 1G/2G) of matrix metalloproteinase-1 (MMP-1) polymorphism and outcome in brain tumor patients diagnosed with a primary brain tumor between 1994 and 2000 at The University of Texas M. D. Anderson Cancer Center. The MMP-1 polymorphism was genotyped for all brain tumor patients who participated in the Family Brain Tumor Study and for whom blood samples were available. Relevant covariates were abstracted from medical records for all cases from the original protocol, including information on demographics, tumor histology, therapy and outcome was obtained. The hypothesis was that brain tumor patients with the 2G allele have a poorer prognosis and shorter survival than brain tumor patients with the 1G allele. ^ Experimental Design: Genetic variants for the MMP-1 enzyme were determined by a polymerase chain reaction-restriction fragment length polymorphism assay. Comparison was made between the overall survival for cases with the 2G polymorphism and overall survival for cases with the 1G polymorphism using multivariable Cox Proportional-Hazard analysis, controlling for age, sex, Karnofsky Performance Scale (KPS), extent of surgery, tumor histology and treatment received. Kaplan-Meier and Cox Proportional-Hazard analyses were utilized to assess if the MMP-1 polymorphisms were related to overall survival. Results: Overall survival was not statistically significantly different between the 2G allele brain tumor patients and the 1G allele patients and there was no statistically significant difference between tumor types. ^ Conclusions: No association was found between MMP-1 polymorphisms and survival in patients with malignant gliomas. ^

Association of TNF-alpha genetic variants with HPV-associated oral cancer risk---a case-control study

The incidence of OSCC in younger population and in those who never smoked or drank has increased since the last decade. This increase may be attributable to increase of infection with HPV. The pro-inflammatory cytokine TNF-&agr; has the role in the pathogenesis of chronic inflammatory diseases and was found to control HPV infection in cervical cancer studies. Our study aimed to investigate the association between the four polymorphisms located in TNF-&agr; promoter region, -308(rs1800629), -857(rs1799724), -863(rs1800630) and -1031(rs1799964), and the risk of HPV-related OSCC. In this hospital-based case-control study, 325 cases and 335 controls were included. We found that HPV 16 seropositivity was associated with an increased risk of oral cancer (OR = 3.1, 95% CI, 2.1–4.6). Each of the polymorphism showed to increase the risk of HPV-related OSCC. And after combining the risk genotypes and using the low-risk group (0–1 combined risk genotypes) and HPV16 seronegativity as the reference group, only the high-risk groups (3–4 combined risk genotypes) and HPV16 seronegativity were associated with a low OR of 1.8 (95% CI, 1.1–2.8), while the low-risk and high-risk groups and HPV16 seropositivity were significantly associated with a higher OR of 2.7 (95% CI, 1.3–5.8) and 8.5 (95% CI, 3.7–19.4), respectively. In addition, the joint effects were greater among the young subjects (aged<50), males, never smokers or never drinkers, and patients with oropharyngeal cancer. Overall, the four TNF-&agr; polymorphisms, individually or collectively, would result in a significantly increased risk for HPV16-associated oral cancer in a non-Hispanic white population. More large sized studies are needed for future investigation.^

NOVEL INDUCERS OF GLIOTOXIN PRODUCTION IN ASPERGILLUS FUMIGATUS

Secondary metabolites are produced by numerous organisms and can either be benign to humans or harmful. Genes involved in the synthesis and transport of these secondary metabolites are frequently found in gene clusters, which are often located in subtelomeric regions of the chromosome. These clusters are often coordinately regulated, being almost exclusively dependent on transcription factors that are located within the clusters themselves. Secondary metabolites are also regulated by a variety of factors, including nutritional factors, environmental factors and developmental processes. Gliotoxin, which is produced by a variety of Aspergillus species, Trichoderma species, and Penicillium species, exhibits immunosuppressive properties and has therefore been the subject of research for many laboratories. There have been a few proteins shown to regulate the gliotoxin cluster, most notably GliZ, a Zn2Cys6 binuclear finger transcription factor that lies within the cluster, and LaeA, a putative methyltransferase that globally regulates secondary metabolism clusters within numerous fungal organisms, although no study has demonstrated the direct binding of any protein to a promoter region in the gliotoxin cluster. I report here two novel proteins, GipA, a C2H2 transcription factor and GipB, a hybrid sensor kinase, which are involved in regulating the gliotoxin biosynthetic cluster. GipA plays an important role in gliotoxin production, as high-copy expression of gipA induces gliotoxin biosynthesis and loss of gipA reduces gliotoxin biosynthesis by 50%. GipB is also involved in regulating gliotoxin production, as high-copy expression of gipB induces gliotoxin biosynthesis, but only during certain stages of asexual development. Furthermore, loss of gipB reduces gliotoxin biosynthesis by 10%. Based on data obtained from this project, I propose a model for the regulation of gliA, the efflux pump of the gliotoxin cluster, which involves GipB signaling through both GliZ and GipA. I propose that GliZ and GipA are interdependent, as mutation of the GipA DNA binding site in the gliA promoter negatively affects both GliZ-mediated and GipA-mediated induction of gliA. This is further supported by the fact that GliZ cannot fully induce gliA in the absence of GipA and vice versa. This is the first time that anyone has shown evidence of a protein directly binding to the gliotoxin cluster. Even though biosynthetic clusters are often coordinately regulated, my model raises the possibility that gliA is independently regulated, as the layout of the binding site in the gliA promoter is not present upstream of any other genes in the gliotoxin cluster, except for gliZ.

Transcriptional regulation of the rat {\it mdr1b\/} gene

The expression of P-glycoproteins encoded by the mdr gene family is associated with the emergence of multidrug-resistance phenotype in animal cells. This gene family includes two members, MDR1 and MDR2, in humans, and three members, mdr1a, mdr1b, and mdr2, in rodents. Among them, the rat mdr1b is known to be highly activated during hepatocarcinogenesis, and its expression is sensitive to the treatment with growth factors, cytotoxic drugs, as well as other physical or chemical stresses. It is believed that the transcriptional regulation plays an important role in above events, however little has been known about mechanisms involved.^ To elucidate how mdr1b expression is regulated, we isolated the genomic sequence of the rat mdr1b and functionally dissected its 5$\prime$ promoter region. Our results demonstrated that: (1) the transcription start site of the rat mdr1b is identical to that of the murine mdr1b homologue; (2) a palindromic sequence from bp $-$189 to $-$180 bp is essential for the basal promoter function of the rat mdr1b, and binds to a specific protein that appears to be a novel transcription factor implicated in the regulation of the rat mdr1b expression; (3) a NF-$\kappa$B-binding site from bp $-$167 to $-$159 is also involved in the basal promoter function. The p65/p50 subunits of the NF-$\kappa$B and raf-1 kinase are implicated in the insulin-inducible promoter activity of the mdr1b, suggesting the important role of NF-$\kappa$B in the regulation of the mdr1b by growth factors; (4) a p53-binding site from bp $-$199 to $-$180 is not only essential for the basal promoter activity but also responsible for the induction of mdr1b by cytotoxic agents. In addition, we provided evidence showing that endogenous mdr1b expression can be modulated by wild-type p53. On the basis of these findings, a model of transcriptional regulation of the rat mdr1b was proposed. ^

Genetic integration of a nuclear -encoded mitochondrial gene with cardiac function

Cardiovascular disease (CVD) is the leading cause of death in the United States. One manifestation of CVD known to increase mortality is an enlarged, or hypertrophic heart. Hypertrophic cardiomyocytes adapt to increased contractile demand at the genetic level with a re-emergence of the fetal gene program and a downregulation of fatty acid oxidation genes with concomitant increased reliance on glucose-based metabolism. To understand the transcriptional regulatory pathways that implement hypertrophic directives we analyzed the upstream promoter region of the muscle specific isoform of the nuclear-encoded mitochondrial gene, carnitine palmitoyltransferase-1β (CPT-1β) in cultured rat neonatal cardiac myocytes. This enzyme catalyzes the rate-limiting step of fatty acid entry into β-oxidation and is downregulated in cardiac hypertrophy and failure, making it an attractive model for the study of hypertrophic gene regulation and metabolic adaptations. We demonstrate that the muscle-enriched transcription factors GATA-4 and SRF synergistically activate CPT-1β; moreover, DNA binding to cognate sites and intact protein structure are required. This mechanism coordinates upregulation of energy generating processes with activation of the energy consuming contractile promoter for cardiac α-actin. We hypothesized that fatty acid or glucose responsive transcription factors may also regulate CPT-1β. Oleate weakly stimulates CPT-1β activity; in contrast, the glucose responsive Upstream Stimulatory Factors (USF) dramatically depresses the CPT-1β reporter. USF regulates CPT-1β through a novel physical interaction with the cofactor PGC-1 and abrogation of MEF2A/PGC-1 synergistic stimulation. In this way, USF can inversely regulate metabolic gene programs and may play a role in the shift of metabolic substrate preference seen in hypertrophy. Failing hearts have elevated expression of the nuclear hormone receptor COUP-TF. We report that COUP-TF significantly suppresses reporter transcription independent of DNA binding and specific interactions with GATA-4, Nkx2.5 or USF. In summary, CPT-1β transcriptional regulation integrates mitochondrial gene expression with two essential cardiac functions: contraction and metabolic substrate oxidation. ^

Expression regulation of AP -2 gamma gene

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Analysis of a human placental lactogen gene promoter

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Characterization of the human tissue transglutaminase gene promoter

Transglutaminases are a family of calcium-dependent enzymes, that catalyze the covalent cross-linking of proteins by forming $\varepsilon(\gamma$-glutamyl)lysine isopeptide bonds. In order to investigate the molecular mechanisms regulating the expression of the tissue transglutaminase gene and to determine its biological functions, the goal of this research has been to clone and characterize the human tissue transglutaminase promoter. Thirteen clones of the tissue transglutaminase gene were obtained from the screening of a human placental genomic DNA library. A 1.74 Kb fragment derived from DNA located immediately upstream of the translation start site was subcloned and sequenced. Sequence analysis of this DNA fragment revealed that it contains a TATA box (TATAA), a CAAT box (GGACAAT), and a series of potential transcription factor binding sites and hormone response elements. Four regions of significant homology, a GC-rich region, a TG-rich region, an AG-rich region, and HR1, were identified by aligning 1.8 Kb of DNA flanking the human, mouse, and guinea pig tissue transglutaminase genes.^ To measure promoter activity, we subcloned the 1.74 Kb fragment of the tissue transglutaminase gene into a luciferase reporter vector to generate transglutaminase promoter/luciferase reporter constructs. Transfection experiments showed that this DNA segment includes a functional promoter with high constitutive activity. Deletion analysis revealed that the SP1 sites or corresponding sequences contribute to this activity. We investigated the role of DNA methylation in regulating the activity of the promoter and found that in vitro methylation of tissue transglutaminase promoter/luciferase reporter constructs suppressed their basal activity. Methylation of the promoter is inversely correlated with the expression of the tissue transglutaminase gene in vivo. These results suggest that DNA methylation may be one of the mechanisms regulating the expression of the gene. The tumor suppressor gene product p53 was also shown to inhibit the activity of the promoter, suggesting that induction of the tissue transglutaminase gene is not involved in the p53-dependent programmed cell death pathway. Although retinoids regulate the expression of the tissue transglutaminase gene in vivo, retinoid-inducible activity can not be identified in 3.7 Kb of DNA 5$\sp\prime$ to the tissue transglutaminase gene.^ The structure of the 5$\sp\prime$ end of the tissue transglutaminase gene was mapped. Alignment analysis of the human tissue transglutaminase gene with other human transglutaminases showed that tissue transglutaminase is the simplest member of transglutaminase superfamily. Transglutaminase genes show a conserved core of exons and introns but diverse N-terminuses and promoters. These observations suggest that key regulatory sequences and promoter elements have been appended upstream of the core transglutaminase gene to generate the diversity of regulated expression and regulated activity characteristic of the transglutaminase gene family. ^

Human TNF receptor p75/80 gene structure and promoter characterization

Tumor necrosis factor receptor p75/80 ((TNF-R p75/80) is a 75 kDa type 1 transmembrane protein expressed predominately on cells of hematopoietic lineage. TNF-R p75/80 belongs to the TNF receptor superfamily characterized by cysteine-rich extracellular regions composed of three to six disulfide-linked domains. In the present report, we have characterized, for the first time, the complete gene structure for human TNF-R p75/80 which spans approximately 43 kbp. The gene consists of 10 exons (ranging from 34 bp to 2.5 kbp) and 9 introns (343 bp to 19 kbp). Consensus elements for transcription factors involved in T cell development and activation were noted in the 5$\sp\prime$ flanking region including TCF-1, Ikaros, AP-1, CK-2, IL-6RE, ISRE, GAS, NF-$\kappa$B and SP1, as well as an unusually high GC content and CpG frequency that appears characteristic of some TNF-R family members. The unusual (GATA)$\sb{\rm n}$ and (GAA)(GGA) repeats found within intron 1 may prove useful for further genome analysis within the 1p36 chromosomal locus. The human TNF-R p75/80 gene structure will permit further assessment of its involvement in normal hematopoietic cell development and function, autoimmune disease, and non-random translocations in hematopoietic malignancies. The region 1.8 kb 5$\sp\prime$ of the ATG was able to drive luciferase expression when transfected into cell lines expressing TNF-R p75/80. Further characterization of the 5$\sp\prime$-regulatory region will aid in determining factors and signal transduction pathways involved in regulating TNF-R p75/80 expression. ^