28 resultados para Nuclear-localization Sequence


Relevância:

80.00% 80.00%

Publicador:

Resumo:

15-Lipoxygenase 2 (15-LOX2) is a recently cloned human lipoxygenase that shows tissue-restricted expression in prostate, lung, skin, and cornea. The protein level and enzymatic activity of 15-LOX2 have been shown to be down-regulated in prostate cancers compared with normal and benign prostate tissues. We report the cloning and functional characterization of 15-LOX2 and its three splice variants (termed 15-LOX2sv-a, 15-LOX2sv-b, and 15-LOX2sv-c) from primary prostate epithelial (NHP) cells. Western blotting with multiple NHP cell strains and prostate cancer (PCa) cell lines reveals that the expression of 15-LOX2 is lost in all PCa cell lines, accompanied by decreased enzymatic activity. 15-LOX2 is expressed at multiple subcellular locations, including cytoplasm, cytoskeleton, cell-cell border, and nucleus. Surprisingly, the three splice variants of 15-LOX2 are mostly excluded from the nucleus. To elucidate the relationship between nuclear localization, enzymatic activity, and tumor suppressive functions, we established PCa cell clones stably expressing 15-LOX2 or 15-LOX2sv-b. The 15-LOX2 clones express 15-LOX2 in the nuclei and possess robust enzymatic activity, whereas 15-LOX2sv-b clones show neither nuclear protein localization nor arachidonic acid-metabolizing activity. Interestingly, both 15-LOX2- and 15-LOX2sv-b-stable clones proliferate much slower in vitro when compared with control clones. When orthotopically implanted in nude mouse prostate, both 15-LOX2 and 15-LOX2sv-b suppress PC3 tumor growth in vivo. Finally, cultured NHP cells lose the expression of putative stem/progenitor cell markers, slow down in proliferation, and enter senescence. Several pieces of evidence implicate 15-LOX2 plays a role in replicative senescence of NHP cells: (1) promoter activity and the mRNA and protein levels of 15-LOX2 and its splice variants are upregulated in serially passaged NHP cells, which precede replicative senescence and occur in a cell-autonomous manner; (2) PCa cells stably expressing 15-LOX2 or 15-LOX2sv-b show a passage-related senescence-like phenotype; (3) enforced expression of 15-LOX2 or 15-LOX2sv-b in young NHP cells induce partial cell-cycle arrest and senescence-like phenotypes. Together, these results suggest that 15-LOX2 suppress prostate tumor development and do not necessarily depend on arachidonic acid-metabolizing activity and nuclear localization. Also, 15-LOX2 may serve as an endogenous prostate senescence gene and its tumor-suppressing functions might be associated with its ability to induce cell senescence. ^

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Several immune pathologies are the result of aberrant regulation of T lymphocytes. Pronounced T cell proliferation can result in autoimmunity or hematologic malignancy, whereas loss of T cell activity can manifest as immunodeficiency. Thus, there is a critical need to characterize the signal transduction pathways that mediate T cell activation so that novel and rational strategies to detect and effectively control T cell mediated disease can be achieved. ^ The first objective of this dissertation was to identify and characterize novel T cell regulatory proteins that are differentially expressed upon antigen induced activation. Using a functional proteomics approach, two members of the prohibitin (Phb) family of proteins, Phb1 and Phb2, were determined to be upregulated upon activation of primary human T cells. Furthermore, their regulated expression was dependent upon CD3 and CD28 signaling pathways which synergistically increased their expression. In contrast to previous reports of Phb nuclear localization, both proteins were determined to localize to the mitochondrial inner membrane of human T cells. Additionally, novel Phb phosphorylation sites were identified and characterized using mass spectrometry, phosphospecific antibodies and site directed mutagenesis. ^ Prohibitins have been proposed to play important roles in cancer development however the mechanism of action has not been elucidated. The second objective of this dissertation was to define the functional role of Phbs in T cell activity, survival and disease. Compared to levels in normal human T cells, Phb expression was higher in the human tumor T cell line Kit225 and subcellularly localized to the mitochondrion. Ablation of Phb expression by siRNA treatment of Kit225 cells resulted in disruption of mitochondrial membrane potential and significantly enhanced their sensitivity to cell death, suggesting they serve a protective function in T cells. Furthermore, Q-RT-PCR analysis of human oncology cDNA expression libraries indicated the Phbs may represent hematological cancer biomarkers. Indeed, Phb1 and Phb2 protein levels were 6-10 fold higher in peripheral blood mononuclear cells isolated from malignant lymphoma and multiple myeloma patients compared to healthy individuals. ^ Taken together, Phb1 and Phb2 are novel phosphoproteins upregulated during T cell activation and transformation to function in the maintenance of mitochondrial integrity and perhaps energy metabolism, thus representing previously unrecognized intracellular biomarkers and therapeutic targets for regulating T cell activation and hematologic malignancies. ^

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The p53 tumor suppressor protein plays a major role in cellular responses to anticancer agents that target DNA. DNA damage triggers the accumulation of p53, resulting in the transactivation of genes, which induce cell cycle arrest to allow for repair of the damaged DNA, or signal apoptosis. The exact role that p53 plays in sensing DNA damage and the functional consequences remain to be investigated. The main goal of this project was to determine if p53 is directly involved in sensing DNA damage induced by anticancer agents and in mediating down-stream cellular responses. This was tested in two experimental models of DNA damage: (1) DNA strand termination caused by anticancer nucleoside analogs and (2) oxidative DNA damage induced by reactive oxygen species (ROS). Mobility shift assays demonstrated that p53 and DNA-PK/Ku form a complex that binds DNA containing the anticancer nucleoside analog gemcitabine monophosphate in vitro. Binding of the p53-DNA-PK/Ku complex to the analog-containing DNA inhibited DNA strand elongation. Furthermore, treatment of cells with gemcitabine resulted in the induction of apoptosis, which was associated with the accumulation of p53 protein, its phosphorylation, and nuclear localization, suggesting the activation of p53 to trigger apoptosis following gemcitabine induced DNA strand termination. The role of p53 as a DNA damage sensor was further demonstrated in response to oxidative DNA damage. Protein pull-down assays demonstrated that p53 complexes with OGG1 and APE, and binds DNA containing the oxidized DNA base 8-oxoG. Importantly, p53 enhances the activities of APE and OGG1 in excising the 8-oxoG residue as shown by functional assays in vitro. This correlated with the more rapid removal of 8-oxoG from DNA in intact cells with wild-type p53 exposed to exogenous ROS stress. Interestingly, persistent exposure to ROS resulted in the accelerated onset of apoptosis in cells with wild-type p53 when compared to isogenic cells lacking p53. Apoptosis in p53+/+ cells was associated with accumulation and phosphorylation of p53 and its nuclear localization. Taken together, these results indicate that p53 plays a key role in sensing DNA damage induced by anticancer nucleoside analogs and ROS, and in triggering down-stream apoptotic responses. This study provides new mechanistic insights into the functions of p53 in cellular responses to anticancer agents. ^

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Monocyte developmental heterogeneity is reflected at the cellular level by differential activation competence, at the molecular level by differential regulation of gene expression. LPS activates monocytes to produce tumor necrosis factor-$\alpha$ (TNF). Events occurring at the molecular level necessary for TNF regulation have not been elucidated, but depend both on activation signals and the maturation state of the cell: Peripheral blood monocytes produce TNF upon LPS stimulation, but only within the first 72 hours of culture. Expression of c-fos is associated with monocytic differentiation and activation; the fos-associated protein, c-jun, is also expressed during monocyte activation. Increased cAMP levels are associated with down regulation of macrophage function, including LPS-induced TNF transcription. Due to these associations, we studied a region of the TNF promoter which resembles the binding sites for both AP-1(fos/jun) and CRE-binding protein (or ATF) in order to identify potential molecular markers defining activation competent populations of monocytic cells.^ Nuclear protein binding studies using extracts from THP-1 monocytic cells stimulated with LPS, which stimulates, or dexamethasone (Dex) or pentoxyfilline (PTX), which inhibit TNF production, respectively, suggest that a low mobility doublet complex may be involved in regulation through this promoter region. PTX or Dex increase binding of these complexes equivalently over untreated cells; approximately two hours after LPS induction, the upper complex is undetectable. The upper complex is composed of ATF2 (CRE-BP1); the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun-ATF2 complexes. The simultaneous presence of both complexes may reduce the amount of TNF transcription through competitive binding, while a loss of the upper (ATF2) and/or gain of the lower (jun-ATF2) allow increased transcription. AP-1 elements generally transduce signals involving PKC; the CRE mediates a cAMP response, involving PKA. Thus, this element has the potential of receiving signals through divergent signalling pathways. Our findings also suggest that cAMP-induced inhibition of macrophage functions may occur via down regulation of activation-associated genes through competitive binding of particular cAMP-responsive nuclear protein complexes. ^

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The nucleus of a eukaryotic cell contains both structural and functional elements that contribute to the controlled operation of the cell. In this context, functional components refers to those nuclear constituents that perform metabolic activities such as DNA replication and RNA transcription. Structural nuclear components, designated nuclear matrix, organize the DNA into loops or domains and appear to provide a framework for nuclear DNA organization. However, the boundary between structural and functional components is not clear cut as evinced by reports of associations between metabolic functions and the nuclear matrix. The studies reported here attempt to determine the relationship of another nuclear function, DNA repair, to the nuclear matrix.^ One objective of these studies was to study the initiation of DNA repair by directly measuring the UV-incision activities in human cells and determine the influence of various extractable nuclear components on these activities. The assay for incision activities required the development of a nuclear isolation protocol that produced nuclei with intact DNA; the conformation of the nuclear DNA and its physical characteristics in response to denaturing conditions were determined.^ The nuclei produced with this protocol were then used as substrates for endogenous UV-specific nuclease activities. The isolated nuclei were shown to contain activities that cause breaks in nuclear DNA in response to UV-irradiation. These UV-responsive activities were tightly associated with nuclear components, being unextractable with salt concentration of up to 0.6 M.^ The tight association of the incision activities with salt-extracted nuclei suggested that other repair function might also be associated with salt-stable components of the nucleus. The site of unscheduled DNA synthesis (UDS) was determined in salt-extracted nuclei (nucleoids) using autoradiography and fluorescent microscopy. UDS was found to occur in association with the nuclear matrix following low-doses (2.55 J/M('2)) of ultraviolet light, but the association became looser after higher doses of ultraviolet light (10-30 J/m('2)). ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Previous results indicated that translation of four mitochondrion-encoded genes and one nucleus-encoded gene (COX4) is repressed in mutants (pgs1Delta) of Saccharomyces cerevisiae lacking phosphatidylglycerol and cardiolipin. COX4 translation was studied here using a mitochondrially targeted green fluorescence protein (mtGFP) fused to the COX4 promoter and its 5' and 3' untranslated regions (UTRs). Lack of mtGFP expression independent of carbon source and strain background was established to be at the translational level. The translational defect was not due to deficiency of mitochondrial respiratory function but was rather caused directly by the lack of phosphatidylglycerol and cardiolipin in mitochondrial membranes. Reintroduction of a functional PGS1 gene under control of the ADH1 promoter restored phosphatidylglycerol synthesis and expression of mtGFP. Deletion analysis of the 5' UTR(COX4) revealed the presence of a 50-nucleotide fragment with two stem-loops as a cis-element inhibiting COX4 translation. Binding of a protein factor(s) specifically to this sequence was observed with cytoplasm from pgs1Delta but not PGS1 cells. Using HIS3 and lacZ as reporters, extragenic spontaneous recessive mutations that allowed expression of His3p and beta-galactosidase were isolated, which appeared to be loss-of-function mutations, suggesting that the genes mutated may encode the trans factors that bind to the cis element in pgs1Delta cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

PURPOSE: To establish the identity of a prominent protein, approximately 70 kDa, that is markedly increased in the retina of monkeys with experimental glaucoma compared with the fellow control retina, the relationship to glaucoma severity, and its localization in the retina. METHODS: Retinal extracts were subjected to 2-D gel electrophoresis to identify differentially expressed proteins. Purified peptides from the abundant 70 kDa protein were analyzed and identified by liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/MS) separation, and collision-induced dissociation sequencing. Protein identity was performed on MASCOT (Matrix Science, Boston, MA) and confirmed by Western blot. The relationship between the increase in this protein and glaucoma severity was investigated by regression analyses. Protein localization in retina was evaluated by immunohistochemistry with confocal imaging. RESULTS: The abundant protein was identified as Macaca mulatta serum albumin precursor (67 kDa) from eight non-overlapping proteolytic fragments, and the identity was confirmed by Western blot. The average increase in retinal albumin content was 2.3 fold (P = 0.015). In glaucoma eyes, albumin was localized to some neurons of the inner nuclear layer, in the inner plexiform layer, and along the vitreal surface, but it was only found in blood vessels in control retinas. CONCLUSIONS: Albumin is the abundant protein found in the glaucomatous monkey retinas. The increased albumin is primarily localized to the inner retina where oxidative damage associated with experimental glaucoma is known to be prominent. Since albumin is a major antioxidant, the increase of albumin in the retinas of eyes with experimental glaucoma may serve to protect the retina against oxidative damage.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Heparanase, an endo-$\beta$-D-glucuronidase, has been associated with melanoma metastasis. Polyclonal antibodies directed against the murine N-terminal heparanase peptide detected a M$\sb{\rm r}\sim 97,000$ protein upon SDS-polyacrylamide gel electrophoresis of mouse melanoma and human melanoma cell lysates. In an indirect immunocytochemical study, metastatic human A375-SM and mouse B16-BL6 melanoma cells were stained with the anti-heparanase antibodies. Heparanase antigen was localized in the cytoplasm of permeabilized melanoma cells as well as at the cell surface of unpermeabilized cells. Immunohistochemical staining of frozen sections from syngeneic mouse organs containing micrometastases of B16-BL6 melanoma demonstrated heparanase localized in metastatic melanoma cells, but not in adjacent normal tissues. Similar studies using frozen sections of malignant melanomas resected from patients indicated that heparanase is localized in invading melanoma cells, but not in adjacent connective tissues.^ Monoclonal antibodies directed against murine heparanase were developed and characterized. Monoclonal antibody 10E5, an IgM, precipitated and inhibitated the enzymatic activity of heparanase. A 2.6 kb cDNA was isolated from a human melanoma $\lambda$gt11 cDNA library using the monoclonal antibody 10E5. Heparan sulfate cleavage activity was detected in the lysogen lysates from E. Coli Y1089 infected with the $\lambda$gt11 cDNA and this activity was inhibited in the presence of 10-fold excess of heparin, a potent inhibitor of heparanase. The nucleotide sequence of the cDNA was determined and insignificant homology was found with the gene sequences currently known. The cDNA hybridized to a 3.2-3.4 kb mRNA in human A375 melanoma, WI-38 fibroblast, and THP-1 leukemia cells using Northern blots.^ Heparanase expression was examined using Western and Northern blots. In comparison to human A375-P melanoma cells, the quantity of 97,000 protein recognized by the polyclonal anti-heparanase antibodies doubled in the metastatic variant A375-SM cells and the quantity of 3.2-3.4 kb mRNA doubled in A375MetMix, a metastatic variant similar to A375-SM cells. In B16 murine melanoma cell, the intensity of the 97,000 protein increased more than 2 times comparing with B16-F1 cells. The extent in the increase of the protein and the mRNA levels is comparable to the change of heparanase activity observed in those cells.^ In summary, the studies suggest that (a) the N-terminus of the heparanase molecule in mouse and human is antigenically related; (b) heparanase antigens are localized at the cell surface and in the cytoplasm of metastatic human and mouse melanoma cells; (c) heparanase antigens are localized in invasive and metastatic murine and human melanomas in vivo, but not in adjacent normal tissues; (d) heparanase molecule appeared to be differentially expressed at the transcriptional as well as at the translational level; and (e) the size of human heparanase mRNA is 3.2-3.4 kilobase. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Frequent loss of heterozygosity (LOH) at specific chromosomal regions are highly associated with the inactivation of tumor suppressor genes (TSGs) (Weinberg, 1991; Bishop, 1989). Chromosome 8p is the most frequently reported site of LOH (∼60%) in prostate cancer (PC), suggesting that there may be inactivated TSG(s) involved in PC on chromosome 8p. (Bergerheim et. al., 1991; Kagan et. al., 1995). In order to identify the smallest common regions of frequent LOH (SCLs) on chromosome 8, we screened 52 PC patient/tumor samples with 39 polymorphic markers in successive screenings. In the course of refining the SCLs, we identified 3 tumors with >6 Mb homozygous deletions (HZDs) at 8p22 and 8p21, suggesting the presence of candidate TSGs at both loci. These HZDs spanned the two SCLs at 8p22 (46%) and 8p21 (45%). The SCLs were narrowed to 3.2 cM at 8p22 and less than 3 cM at 8p21. ^ In order to identify candidate TSGs within the SCLs on 8p, two approaches were used. In the candidate gene approach, thirty genes that mapped to the SCLs were evaluated for expression in normal prostate and in PC cell lines. One of the candidate genes, Clusterin, showed decreased expression in 4/7 (57%) prostate cancer cell lines by Northern blot analysis. Clusterin will be further examined as a candidate TSG. ^ The second approach involved utilizing subtractive hybridization and hybrid affinity capture to generate pools of expressed sequence tags (ESTs) enriched for genes that are downregulated or deleted in PC and that map to specific regions of interest. We took advantage of a prostate cancer cell line (PC3) with a known HZD of a candidate TSG, CTNNA1 on 5q31, to develop and validate a model system. We then developed subtracted libraries enriched for 8p22 and 8p21 ESTs by this method, using two cell lines, MDAPCa-2b and PC3. The ESTs were cloned, and 40 were sequenced and evaluated for expression in normal prostate and PC cell lines. Three ESTs from the subtracted libraries, C2, C17 and F12, showed decreased expression in 29–57% of the prostate tumor cell lines studied, and will be further examined as candidate TSGs. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In many organisms, polarity of the oocyte is established post-transcriptionally via subcellular RNA localization. Many RNAs are localized during oogenesis in Xenopus laevis, including Xlsirts ( Xenopus laevis short interspersed repeat transcripts) [Kloc, 1993]. Xlsirts constitute a large family defined by highly homologous repeat units 79–81 nucleotides in length. Endogenous Xlsirt RNAs use the METRO (Message Transport Organizer) pathway of localization, where RNAs are transported from the nucleus to the mitochondrial cloud in stage I oocytes. Secondly, RNAs anchor at the vegetal pole in stage II oocytes. Exogenous Xlsirt RNAs can also utilize the Late pathway of localization, which involves localization to the vegetal cortex during stage III of oogenesis and results in RNAs anchored in the cortex of the entire vegetal hemisphere. ^ The Xlsirts localization signal is contained within the repeat region. This study was designed to test the hypothesis that there are cis -acting localization elements in Xlsirts, and that higher order structure plays a role. Results of experiments on Xlsirt P11, a 1700 basepair (bp) family member, led to the conclusion that a 137-bp fragment of the repetitive region is necessary and sufficient for METRO and Late pathway localization. This analysis definitively demonstrates that the Xlsirt localization signal for the METRO and Late pathways reside within the repetitive region and not within the flanking regions. Analysis of Xlsirt linker scanning mutations revealed two METRO-pathway specific subelements, and one Late-pathway specific subelement. Functional, computer, and biochemical evidence relates the higher order structure of this element to its ability to function as a localization element. ^ Xlsirt 137 is 99% identical to the Xlsirt consensus sequence identified in this study, suggesting that it is the localization element for all localized Xlsirt family members. The repeat unit was reframed based on function, rather than arbitrarily based on sequence. This work supports the hypothesis presented in 1981 by George Spohr, who originally isolated the Xlsirts, which stated that the highly conserved repetitive elements must be constrained from variability due to some unknown function of the repeats themselves. These studies shed light on the mechanism of RNA localization, linking structure and function. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Activation of Rho family small G proteins is thought to be a critical event in breast cancer development and metastatic progression. Rho protein activation is stimulated by a family of enzymes known as guanine nucleotide exchange factors (Rho GEFs). The neuroepithelioma transforming gene 1 (Net1) is a Rho GEF specific for the RhoA subfamily that is overexpressed in primary breast tumors and breast cancer cell lines. Net1 isoform expression is also required for migration and invasion of breast cancer cells in vitro. These data indicate that Net1 may be a critical regulator of metastatic progression in breast cancer. Net1 activity is negatively regulated by sequestration in the nucleus, and relocalization of Net1 outside the nucleus is required to stimulate RhoA activation, actin cytoskeletal reorganization, and oncogenic transformation. However, regulatory mechanisms controlling the extranuclear localization of Net1 have not been identified. In this study, we have addressed the regulation of Net1A isoform localization by Rac1. Specifically, co-expression of constitutively active Rac1 with Net1A stimulates the relocalization of Net1A from the nucleus to the plasma membrane in breast cancer cells, and results in Net1A activation. Importantly, Net1A localization is also driven by endogenous Rac1 activity. Net1A relocalizes outside the nucleus in cells spreading on collagen, and when endogenous Rac1 expression was silenced by siRNA, Net1A remained nuclear in spreading cells. These data indicate that Rac1 controls the localization of the Net1A isoform and suggests a physiological role for Net1A in breast cancer cell adhesion and motility.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An interleaved, dual resonance, volume localization technique for $\sp1$H/$\sp{31}$P magnetic resonance spectroscopy has been designed, implemented on a 2 T imager/spectrometer, and verified with phantom studies.^ Localization techniques, including several single voxel techniques and spectroscopic imaging, were implemented, and studies were performed to compare the efficiency of each sequence of $\sp1$H/$\sp{31}$P spectral acquisitions. The sequence chosen was a hybrid of the stimulated echo single voxel technique and the spectroscopic imaging technique.^ Water suppression during the $\sp1$H spectral acquisitions was accomplished by the use of three narrow bandwidth RF saturation pulses in combination with three spoiler gradients. The spoiler gradient amplitudes were selected on the basis of a numerical solution of the Bloch equations. A post-acquisition water suppression algorithm was used to minimize any residual water signal.^ For interleaved $\sp1$H/$\sp{31}$P acquisitions, a dual resonance RF coil was constructed and interfaced to the existing RF detection system via a custom-designed dual resonance transcoupler and switching system. Programmable attenuators were incorporated to allow for changes in receiver and transmitter attenuation "on the fly".^ To provide the rapidly switched gradient fields required for the $\sp1$H/$\sp{31}$P acquisitions, an actively screened gradient coil system was designed and implemented. With this system, gradient field rise times on the order of 100 $\mu$s were obtained. These rapid switching times were necessary for minimizing intrasequence delays and for improving localization quality and water suppression efficiency.^ The interleaved $\sp1$H/$\sp{31}$P volume localization technique was tested using a two-compartment phantom. Analysis of the data showed that the spectral contamination was less than three percent. One-to-one spatial correspondence of the $\sp1$H and $\sp{31}$P spectra was verified and allowed for direct correlation of the spectral data with a standard magnetic resonance image. ^