19 resultados para HeLa Cells
Resumo:
DNA ligase and DNA polymerase play important roles in DNA replication, repair, and recombination. Frequencies of spontaneous and chemical- and physical-induced mutations are correlated to the fidelity of DNA replication. This dissertation elucidates the mechanisms of the DNA ligation reaction by DNA ligases and demonstrates that human DNA ligase I and DNA polymerase $\alpha$ are the molecular targets for two metal ions, Zn$\sp{2+}$ and Cd$\sp{2+},$ and an anticancer drug, F-ara-ATP.^ Human DNA ligases were purified to homogeneity and their AMP binding domains were mapped. Although their AMP-binding domains are similar, there could be difference between the two ligases in their DNA binding domains.^ The formation of the AMP-DNA intermediate and the successive ligation reaction by human DNA ligases were analyzed. Both reactions showed their substrate specificity for ligases I and II, required Mg2+, and were inhibited by ATP.^ A protein inhibitor from HeLa cells and specific for human DNA ligase I but not ligase II and T4 ligase was discovered. It reversibly inhibited DNA ligation activity but not the AMP-binding activity due to the formation of a reversible ligase I-inhibitor complex.^ F-ara-ATP inhibited human DNA ligase I activity by competing with ATP for the AMP-binding site of DNA ligase I, forming a ligase I-F-ara-AMP complex, as well as when it was incorporated at 3$\sp\prime$-terminus of DNA nick by DNA polymerase $\alpha.$^ All steps of the DNA ligation reaction were inhibited by Zn$\sp{2+}$ and Cd$\sp{2+}$ in a concentration-dependent manner. Both ions did not show the ability to change the fidelity of DNA ligation reaction catalyzed by human DNA ligase I. However, Zn$\sp{2+}$ and Cd$\sp{2+}$ showed their contradictory effects on the fidelity of the reaction by human DNA polymerase $\alpha.$ Zn$\sp{2+}$ decreased the frequency of misinsertion but less affected that of mispair extension. On the contrary, Cd$\sp{2+}$ increased the frequencies of both misinsertion and mispair extension at very low concentration. Our data provided strong evidence in the molecular mechanisms for the mutagenicity of zinc and cadmium, and were comparable with the results previously reported. ^
Resumo:
Although coagulase-negative staphylococci (C-NS) have been implicated in certain human infections, they are generally regarded as contaminants and their clinical significance is questioned. To assess their role as pathogens, 205 isolates of C-NS from wounds, and body fluids (blood, urine, pleural and peritoneal fluids, etc.) were studied. Patient's charts were reviewed and using strict criteria a determination was made regarding the clinical significance of these isolates. The organisms were then identified using the scheme of Kloos and Schleifer to determine if certain species of C-NS were associated with specific infections. S. epidermidis sensu stricto accounted for 81% of the C-NS isolated; the frequency of other species was S. haemolyticus (6%), S. hominis (5%), S. capitis (4%), S. warneri (3%), and others (1%). Only two isolates were novobiocin resistant; neither was identified as S. saprophyticus. Using these criteria, 22% of C-NS were considered to be clinically significant and the majority of these (93%) were due to S. epidermidis. The most common source of the clinically relevant C-NS isolates was from wounds. These data suggest that identifying C-NS species other than S. epidermidis may be of limited value in predicting clinical significance.^ In addition, selected pathogenic and non-pathogenic strains of C-NS were compared for their ability to adhere to human cells in vitro. Although the results were not conclusive, it appeared that pathogenic C-NS adhered more avidly than non-pathogenic C-NS to buccal cells. Experiments with HeLa cells showed no difference between pathogenic and non-pathogenic C-NS in adherence abilities. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Studies on the transcriptional regulation of serum amyloid A1 (SAA1) gene, a liver specific acute-phase gene, identified a regulatory element in its promoter that functioned to repress (SAA1) gene transcription in nonliver cells. This silencer element interacts with a nuclear protein that is detectable in HeLa cells, fibroblasts and placental tissues but not in liver or liver-derived cells. As the expression pattern of this repressor is consistent with its potential regulatory role in repressing SAA1 expression, and that many other liver gene promoters also contain this repressor binding site, we sought to investigate whether this repressor may have a broader functional role in repressing liver genes. ^ We have utilized protein purification, cell culture, transient and stable gene transfection, and molecular biology approaches to identify this protein and investigate its possible function in the regulation of (SAA1) and other liver genes. Analyses of amino acid sequence of the purified nuclear protein, and western blot and gel shift studies identified the repressor as transcription factor AP-2 or AP-2-like protein. Using transient transfection of DNA into cultured cells, we demonstrate that AP-2 can indeed function as a repressor to inhibit transcription of SAA1 gene promoter. This conclusion is supported by the following experimental results: (1) overexpression of AP-2 in hepatoma cells inhibits conditioned medium (CM)-induced expression of SAA1 promoter; (2) binding of AP-2 to the SAA1 promoter is required for AP-2 repression function; (3) one mechanism by which AP-2 inhibits SAA1 may be by antagonizing the activation function of the strong transactivator NFκB; (4) mutation of AP-2 binding sites results in derepression of SAM promoter in HeLa cells; and (5) inhibition of endogenous AP-2 activity by a dominant-negative mutant abolishes AP-2's inhibitory effect on SAM promoter in HeLa cells. In addition to the SAM promoter, AP-2 also can bind to the promoter regions of six other liver genes tested, suggesting that it may have a broad functional role in restricting the expression of many liver genes in nonliver cells. Consistent with this notion, ectopic expression of AP-2 also represses CM-mediated activation of human third component of complement 3 promoter. Finally, in AP-2-expressing stable hepatoma cell lines, AP-2 inhibits not only the expression of endogenous SAA, but also the expression of several other endogenous liver genes including albumin, α-fetoprotein. ^ Our findings that AP-2 has the ability to repress the expression of liver genes in nonliver cells opens a new avenue of investigation of negative regulation of gene transcription, and should improve our understanding of tissue-specific expression of liver genes. In summary, our data provide evidence suggesting a novel role of AP-2 as a repressor, inhibiting the expression of liver genes in nonliver cells. Thus, the tissue-specific expression of AP-2 may constitute an important mechanism contributing to the liver-specific expression of liver genes. ^