Galectin-3 Enhances the Malignant Melanoma Phenotype by Regulating Autotaxin

In melanoma patient specimens and cell lines, the over expression of galectin-3 is associated with disease progression and metastatic potential. Herein, we have sought out to determine whether galectin-3 affects the malignant melanoma phenotype by regulating downstream target genes. To that end, galectin-3 was stably silenced by utilizing the lentivirus-incorporated small hairpin RNA in two metastatic melanoma cell lines, WM2664 and A375SM, and subjected to gene expression microarray analysis. We identified and validated the lysophospholipase D enzyme, autotaxin, a promoter of migration, invasion, and tumorigenesis, to be down regulated after silencing galectin-3. Silencing galectin-3 significantly reduced the promoter activity of autotaxin. Interestingly, we also found the transcription factor NFAT1 to have reduced protein expression after silencing galectin-3. Electrophoretic mobility shift assays from previous reports have shown that NFAT1 binds to the autotaxin promoter in two locations. ChIP analysis was performed, and we observed a complete loss of bound NFAT1 to the autotaxin promoter after silencing galectin-3 in melanoma cells. Mutation of the NFAT1 binding sites at either location reduces autotaxin promoter activity. Silencing NFAT1 reduces autotaxin expression while over expressing NFAT1 in NFAT1 negative SB-2 melanoma cells induces autotaxin expression. These data suggest that galectin-3 silencing reduces autotaxin transcription by reducing the amount of NFAT1 protein expression. Rescue of galectin-3 rescues both NFAT1 and autotaxin. We also show that the re-expression of autotaxin in galectin-3 shRNA melanoma cells rescues the angiogenic phenotype in vivo. Furthermore, we identify NFAT1 as a potent inducer of tumor growth and experimental lung metastasis. Our data elucidate a previously unidentified mechanism by which galectin-3 regulates autotaxin and assign a novel role for NFAT1 during melanoma progression.

Role and regulation of c-KIT gene expression in tumor growth and metastasis of human melanoma

The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^

A distinct element involved in the lipopolysaccharide activation of the tumor necrosis factor -alpha promoter in a promonocytic cell line, THP-1

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^

Expression regulation of AP -2 gamma gene

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^

A conserved motif at the 3$\sp\prime$ end of genomic RNA of mouse hepatitis virus required for host protein binding and viral RNA replication

The initial step in coronavirus-mouse hepatitis virus (MHV) replication is the synthesis of negative strand RNA from a positive strand genomic RNA template. Our approach to studying MHV RNA replication is to identify the cis-acting signals for RNA synthesis and the protein(s) which recognizes these signals at the 3$\sp\prime$ end of genomic RNA of MHV. To determine whether host cellular and/or virus-specific proteins interact with the 3$\sp\prime$ end of the coronavirus genome, an RNase T$\sb1$ protection/gel mobility shift electrophoresis assay was used to examine cytoplasmic extracts from either mock- or MHV-JHM-infected 17Cl-1 murine cells for the ability to form complexes with defined regions of the genomic RNA. A conserved 11 nucleotide sequence UGAAUGAAGUU at nucleotide positions 36 to 26 from the 3$\sp\prime$ end of genomic RNA was identified to be responsible for the specific binding of host proteins, by using a series of RNA probes with deletions and mutations in this region. The RNA probe containing the 11 nucleotide sequence bound approximately four host cellular proteins with a highly labeled 120 kDa and three minor species with sizes of 103, 81 and 55 kDa, assayed by UV-induced covalent cross-linking. Mutation of the 11 nucleotide motif strongly inhibited cellular protein binding, and decreased the amount of the 103 and 81 kDa proteins in the complex to undetectable levels and strongly reduced the binding of the 120 kDa protein. Less extensive mutations within this 11 nucleotide motif resulted in variable decreases in RNA-protein complex formation depending on each probe tested. The RNA-protein complexes observed with cytoplasmic extracts from MHV-JHM-infected cells in both RNase protection/gel mobility shift and UV cross-linking assays were indistinguishable to those observed with extracts from uninfected cells.^ To investigate the possible role of this 3$\sp\prime$ protein binding element in viral RNA replication in vivo, defective interfering RNA molecules with complete or partial mutations of the 11 nucleotide conserved sequence were transcribed in vitro, transfected to host 17Cl-1 cells in the presence of helper virus MHV-JHM and analyzed by agarose gel electrophoresis, competitive RT-PCR and direct sequencing of the RT-PCR products. Both negative strand synthesis and positive strand replication of DI RNA were affected by mutation that disrupts RNA-protein complex formation, even though the 11 mutated nucleotides were converted to wild type sequence, presumably by recombination with helper virus. Kinetic analysis indicated that recombination between DI RNA and helper virus occurred 5.5 to 7.5 hours post infection when replication of positive strand DI RNA was barely observed. Replication of positive strand DI RNAs carrying partial mutations within the 11 nucleotide motif was dependent upon recombination events after transfection. Replication was strongly inhibited when reversion to wild type sequence did not occur, and after recombination, reached similar levels as wild type DI RNA. A DI RNA with mutation upstream of the protein binding motif replicated as efficiently as wild type without undergoing recombination. Thus the conserved 11 nucleotide host protein binding motif appears to play an important role in viral RNA replication. ^

Human placental lactogen enhancer: Tissue specificity and binding with specific proteins

Human placental lactogen (hPL) is a 22,000 dalton protein hormone produced in the placenta. The physiological actions of hPL are not well understood but its major activity is to regulate both maternal and fetal metabolism. hPL stimulates maternal lipolysis increasing free fatty acids in the maternal blood, allowing their use as an energy source by the mother, and sparing glucose for the fetus. It may also act as a growth promoting hormone for the fetus. hPL is produced in increasing amounts as pregnancy progresses. At term, hPL accounts for 10% of protein and 5% of total RNA in the placenta. This high level of hPL production is tissue-specific, as hPL is only produced in the placenta by syncytiotrophoblast cells.^ The objective of this work was to understand the mechanism by which such high levels of hPL are produced in a tissue-specific manner. A transcriptional enhancer found 2.2 kb 3$\sp\prime$ to one of the hPL genes (hPL$\sb3$) may explain the regulation of hPL expression. Transient transfection experiments using the hPL-producing human choriocarcinoma cell line JEG-3 localized the hPL enhancer to a 138 bp core element. This 138 bp sequence was found to be tissue specific in its actions as it did not promote transcription in heterologous cell lines. Gel mobility shift assays showed the hPL enhancer interacts specifically with nuclear proteins unique to hPL-producing cells. Within the 138 bp enhancer a 22 bp region was shown to be protected from DNase I digestion due to binding of proteins derived from placental nuclear extracts. Proteins binding this region of the enhancer may be instrumental in the tissue specific activity of the hPL enhancer. ^

{\it RAS\/} is required for the expression of interleukin-1$\beta$ in two diverse leukemic cell lines

Under normal physiological conditions, cells of the hematopoietic system produce Interleukin-1$\beta$(IL-1$\beta)$ only when a stimulus is present. Leukemic cells, however, can constitutively produce this cytokine without an exogenous source of activation. In addition, IL-1$\beta$ can operate as an autocrine and/or paracrine growth factor for leukemic blasts. In order to study the cellular basis for this aberrant production, we analyzed two leukemic cell lines (B1 and W1) which express high levels of IL-1$\beta$ and use IL-1$\beta$ as an autocrine growth factor. Initial studies demonstrated: (1) lack of rearrangement and/or amplification in the IL-1$\beta$ gene and its promoter; and (2) intact responsiveness to regulators such as cycloheximide and dexamethasone, implying that the molecular defect was upstream. Analysis of the Ras inducible transcription factors by gel shift assay demonstrated constitutive transcription factor binding in the IL-1$\beta$ promoter. Furthermore, RAS mutations were found at codon 12 in the K-RAS and N-RAS genes in the B1 and W1 cells, respectively. To deduce the effects of activated Ras on IL-1$\beta$ expression, two classes of farnesyltransferase inhibitors and an adenoviral vector expressing antisense targeted to K-RAS were utilized. The farnesyltransferase inhibitors perillyl alcohol and B581 were able to reduce IL-1$\beta$ levels by 80% and 50% in the B1 cells, respectively. In W1 cells, IL-1$\beta$ was reduced by 60% with 1mM perillyl alcohol. Antisense RNA targeted to K-RAS confirmed the results demonstrating a 50% reduction in IL-1$\beta$ expression in the B1 cells. In addition, decreased binding at the crucial NF-IL6/CREB binding site correlated with decreased IL-1$\beta$ production and cellular proliferation implying that this site was a downstream effector of Ras signaling. Our data suggest that mutated RAS genes may be responsible for autocrine IL-1$\beta$ production in some leukemias by stimulating signal transduction pathways that activate the IL-1$\beta$ promoter. ^

A urokinase receptor promoter element (-152/-135) bound with an AP-2-alpha-related protein and SP1 is required for the induction of gene expression by PMA and SRC

The urokinase-type plasminogen activator receptor (u-PAR) promotes extracellular matrix degradation, invasion and metastasis. A first objective of this dissertation was to identify cis-elements and trans-acting factors activating u-PAR gene expression through a previously footprinted (–148/–124) promoter region. Mobility shifting experiments on nuclear extracts of a high u-PAR-expressing colon cancer cell line (RKO) indicated Sp1, Sp3 and a factor similar to, but distinct from, AP-2α bound to an oligonucleotide spanning –152/–135. Mutations preventing the binding of the AP-2α-related factor reduced u-PAR promoter activity. In RKO, the expression of a dominant negative AP-2 (AP-2αB) diminished u-PAR promoter activity, protein and u-PAR mediated laminin degradation. Conversely, u-PAR promoter activity in low u-PAR-expressing GEO cells was increased by AP-2αA expression. PMA treatment, which induces u-PAR expression, caused an increased amount of the AP-2α-related factor-containing complex in GEO, and mutations preventing AP-2α-like and Sp1/Sp3 binding reduced the u-PAR promoter stimulation by PMA. In resected colon cancers, u-PAR protein amounts were related to the amount of the AP-2α-related factor-containing complex. In conclusion, constitutive and PMA- inducible u-PAR gene expression and -proteolysis are mediated partly through transactivation via a promoter sequence (–152/435) bound with an AP-2α-related factor and Sp1/Sp3. ^ A second interest of this dissertation was to determine if a constitutively active Src regulates the transcription of the u-PAR gene, since c-src expression increases invasion in colon cancer. Increased u-PAR protein and laminin degradation paralleling elevated Src activity was evident in SW480 colon cancer cells stably expressing a constitutively active Src (Y- c-src527F). Nuclear run-on experiments indicated that this was due largely to transcriptional activation. While transient transfection of SW480 cells with Y-c-src527F induced a u-PAR-CAT-reporter, mutations preventing Sp1-binding to promoter region –152/435 abolished this induction. Mobility shift assays revealed increased Sp1 binding to region –152/135 with nuclear extracts of Src-transfected SW480 cells. Finally, the amounts of endogenous u-PAR in resected colon cancers significantly correlated with Src-activity. These data suggest that u-PAR gene expression and proteolysis are regulated by Src, this requiring the promoter region (–152/–135) bound with Sp1, thus, demonstrating for the first time that transcription factor Sp1 is a downstream effector of Src. ^

NADPH-CYTOCHROME P-450 REDUCTASE: EVIDENCE FOR TWO SEPARATE STRUCTURAL DOMAINS AND ISOLATION AND CHARACTERIZATION OF THE MEMBRANE ASSOCIATED SEGMENT

Homogenous detergent-solubilized NADPH-Cytochrome P-450 reductase was incorporated into microsomes and liposomes. This binding occurred spontaneously at temperatures between 4(DEGREES) and 37(DEGREES) and appeared to involve hydrophobic forces as the binding was not disrupted by 0.5 M sodium chloride. This exogenously-added reductase was active catalytically towards native cytochrome P-450, suggesting an association with the microsomal membrane similar to endogenous reductase. Homogeneous detergent-solubilized reductase was disaggregated by Renex-690 micelles, confirming the presence of a hydrophobic combining region on the enzyme. In contrast to these results, steapsin protease-solubilized reductase was incapable of microsomal attachment and did not interact with Renex-690 micelles. Detergent-solubilized reductase (76,500 daltons) was converted into a form with the electrophoretic mobility of steapsin protease-solubilized reductase (68,000 daltons) and a 12,500 dalton peptide (as determined by polyacrylamide-SDS gel electrophoresis) when the liposomal-incorporated enzyme was incubated with steapsin protease. The 68,000 dalton fragment thus obtained had properties identical with steapsin protease-solubilized reductase, i.e. it was catalytically active towards cytochrome c but inactive towards cytochrome P-450 and did not bind liposomes. The 12,500 dalton fragment remained associated with the liposomes when the digest was fractionated by gel filtration, suggesting that this is the segment of the enzyme which is embedded in the phospholipid bilayer. Thus, detergent-solubilized reductase appears to contain a soluble catalytic domain and a separate and separable membrane-binding domain. This latter domain is required for attaching the enzyme to the membrane and also to facilitate the catalytic interaction between the reductase and its native electron acceptor, cytochrome P-450. The membrane-binding segment of the reductase was isolated by preparative gel electrophoresis in SDS following its generation by proteolytic treatment of liposome-incorporated reductase. The peptide has a molecular weight of 6,400 as determined by gel filtration in 8 M guanidine hydrochloride and has an amino acid composition which is not especially hydrophobic. Following removal of SDS and dialysis out of 6 M urea, the membrane-binding peptide was unable to inhibit the activity of a reconstituted system containing purified reductase and cytochrome P-450. Moreover, when reductase and cytochrome P-450 were added to liposomes which contained the membrane-binding peptide, it was determined that mixed function oxidase activity was reconstituted as effectively as when vesicles without the membrane-binding peptide were used. Thus, the membrane-binding peptide was ineffective as an inhibitor of mixed function oxidase activity, suggesting perhaps that it facilitates catalysis by anchoring the catalytic domain of the reductase proximal to cytochrome P-450 (i.e. in the same mixed micelle) rather than through a specific interaction with cytochrome P-450. ^

STUDIES ON THE PATTERNS OF NUCLEOTIDE AND AMINO ACID SUBSTITUTION (ELECTROPHORESIS, MUTATION RATE, SELECTION, BASE, COMPOSITION)

Theoretical and empirical studies were conducted on the pattern of nucleotide and amino acid substitution in evolution, taking into account the effects of mutation at the nucleotide level and purifying selection at the amino acid level. A theoretical model for predicting the evolutionary change in electrophoretic mobility of a protein was also developed by using information on the pattern of amino acid substitution. The specific problems studied and the main results obtained are as follows: (1) Estimation of the pattern of nucleotide substitution in DNA nuclear genomes. The pattern of point mutations and nucleotide substitutions among the four different nucleotides are inferred from the evolutionary changes of pseudogenes and functional genes, respectively. Both patterns are non-random, the rate of change varying considerably with nucleotide pair, and that in both cases transitions occur somewhat more frequently than transversions. In protein evolution, substitution occurs more often between amino acids with similar physico-chemical properties than between dissimilar amino acids. (2) Estimation of the pattern of nucleotide substitution in RNA genomes. The majority of mutations in retroviruses accumulate at the reverse transcription stage. Selection at the amino acid level is very weak, and almost non-existent between synonymous codons. The pattern of mutation is very different from that in DNA genomes. Nevertheless, the pattern of purifying selection at the amino acid level is similar to that in DNA genomes, although selection intensity is much weaker. (3) Evaluation of the determinants of molecular evolutionary rates in protein-coding genes. Based on rates of nucleotide substitution for mammalian genes, the rate of amino acid substitution of a protein is determined by its amino acid composition. The content of glycine is shown to correlate strongly and negatively with the rate of substitution. Empirical formulae, called indices of mutability, are developed in order to predict the rate of molecular evolution of a protein from data on its amino acid sequence. (4) Studies on the evolutionary patterns of electrophoretic mobility of proteins. A theoretical model was constructed that predicts the electric charge of a protein at any given pH and its isoelectric point from data on its primary and quaternary structures. Using this model, the evolutionary change in electrophoretic mobilities of different proteins and the expected amount of electrophoretically hidden genetic variation were studied. In the absence of selection for the pI value, proteins will on the average evolve toward a mildly basic pI. (Abstract shortened with permission of author.) ^

Xp95 is phosphorylated within the proline rich domain during Xenopus oocyte maturation

Xp95 is the Xenopus ortholog of a conserved family of scaffold proteins that have in common an N-terminal Bro1 domain and a C-terminal proline rich domain (PRD). The regulation of this protein family is poorly understood. We previously showed that Xp95 undergoes a phosphorylation-dependant gel mobility shift during meiotic maturation of Xenopus oocytes, the only natural biological system in which post-translational modifications of this family has been demonstrated. Here we characterized Xp95 phosphorylation via two approaches. First, we tested a series of Xp95 fragments for the ability to gel-shift during oocyte maturation, and found that a fragment containing amino acids 705-786 is sufficient to cause a gel-shift. This fragment is within the N-terminal region of Xp95's PRD (N-PRD). Second, we purified phosphorylated Xp95 and by mass spectrometry found that a 5080 Da peptide which maps to N-PRD (amino acids 706-756) contains two phosphorylation sites, one of which is T745, within the conserved CIN85 binding motif. By in vitro protein interaction assays, we that T745 is critical for CIN85/Xp95 interaction, and that Xp95 phosphorylation correlates with loss of binding to CIN85. We also show that an Alix fragment (amino acids 604-789) also undergoes a gel-shift during oocyte maturation and during colcemid-induced mitotic arrest of HeLa cells. These findings indicate that Xp95/Alix is phosphorylated on the PRD during M phase induction and that the PRD phosphorylation regulates partner protein interaction. ^

Identification and functional characterization of novel phosphotyrosine and phosphoserine residues in the interleukin-2 receptor complex

Interleukin-2 (IL-2) is a major T cell growth factor and plays an essential role in the development of normal immune responses. The Janus kinases (Jaks) and Signal transducers and activators of transcription (Stats) are critical for transducing signals from the IL-2 receptors (IL2Rs) to the nucleus to control cell growth and differentiation. In recent years there has been increasing evidence to indicate that the IL-2 activated Jak3/Stat5 pathway provides a new molecular target for immune suppression. Thus, understanding the regulation of this effector cascade has important therapeutic potential.^ One objective of this work was to identify and define the role and molecular mechanism of novel phosphorylation sites in Jak3. Using functional proteomics, three novel Jak3 phosphorylation sites, Y904, Y939 and S574 were identified. Phosphospecific antibodies confirmed that phosphorylation of Y904 and Y939 were mediated by IL-2 and other IL-2 family cytokines in distinct cell types. Biochemical analysis demonstrated that phosphorylation of both Y904 and Y939 positively regulated Jak3 enzymatic activity, while phosphorylation of S574 did not affect Jak3 in vitro kinase activity. However, a gain-of-function mutation of S574 in Jak3 abrogated IL-2 mediated Stat5 activation, suggesting that phosphorylation of this residue might serve a negative role to attenuate IL-2 signaling. Furthermore, mechanistic analysis suggested that phosphorylation of Y904 in Jak3 affects the KmATP of Jak3, while phosphorylation of Y939 in Jak3 was required to bind one of its substrates, Stat5.^ The second objective was to determine the role of serine/threonine phosphatases in the regulation of the IL2R complex. Activation of Jak3 and Stat5 by IL-2 is a transient event mediated by phosphorylation. Using a specific PP1/PP2A inhibitor, we observed that inhibition of PP1/PP2A negatively regulated the IL-2 activated Jak3/Stat5 signaling pathway in a human NK cell line (YT) and primary human T cells. More importantly, coimmunoprecipitation assays indicated that inhibition of PP1/PP2A blocked the formation of an active IL2R complex. Pretreatment of cells with the inhibitor also reduced the electrophoretic mobility of the IL2Rβ and IL2Rγ subunits in YT cells, suggesting that inhibition of PP1/PP2A directly or indirectly regulates undefined serine/threonine kinases which phosphorylate these proteins. Based on these observations, a model has emerged that serine/threonine phosphorylation of the IL2Rβ and IL2Rγ subunits causes a conformational change of these proteins, which disrupts IL2R dimerization and association of Jak3 and Stat5 to these receptors.^

Homeostatic transcriptional regulation of bcl-2 in the epidermis

Bcl-2, a crucial regulator of cell survival, is frequently overexpressed in basal cell carcinomas (BCCs), the most commonly diagnosed cancers. Regulation of bcl-2 expression in epidermal keratinocytes is not well characterized. In the epidermis, bcl-2 is expressed only in keratinocytes of the basal layer and the outer root sheath of hair follicles and no bcl-2 expression in suprabasalar keratinocytes. The calcium gradient in the epidermis is a potent regulator of keratinocyte differentiation. Increasing calcium concentrations associated with differentiation, resulted in the downregulation of a 2.9 kb bcl-2 promoter luciferase construct. The AP-1 family of transcription factors is differentially expressed in the strata of the epidermis and has been shown to be involved in the stage specific expression of numerous differentiation markers in the epidermis. In silico analysis of the bcl-2 promoter and gene reporter assays showed that co-transfection of JUNB and JUND, but not other AP-1 dimers, caused a significant upregulation of the bcl-2 promoter in primary keratinocytes. Immunoelectrophoretic mobility shift assays, in vivo chromatin immunoprecipitation (ChIP) studies and mutational analysis of AP-1 binding site 3 on the bcl-2 promoter identified it as the site involved in bcl-2 regulation. Utilizing site directed mutants, we determined that phosphorylation at Ser90/Ser100 residues of JUND is required for the activation of the bcl-2 promoter. ^ The sonic hedgehog (SHH) pathway is frequently deregulated in BCCs and, we have shown that GLI1 upregulates bcl-2 in keratinocytes. While examining potential regulation of the SHH pathway extracellular calcium, we found that higher calcium concentrations are associated with lowered HH pathway activity and upregulation of suppressor of fused (SUFU) which negatively regulates the SHH pathway. ChIP assays, and in vivo mouse models, show that ΔNp63α, a crucial regulator of epidermal development, binds and activates the SUFU promoter in differentiating keratinocytes. Increasing SUFU levels prevent transactivation of the bcl-2 promoter. In vitro SUFU knockdown along with in vivo SUFU+/− murine models demonstrate a significant upregulation of bcl-2 expression. ^ In conclusion, the spatial and temporal expression of bcl-2 during keratinocyte differentiation in the epidermis is a complex process requiring cooperative interactions of specific signaling cascades and transcription factors. ^

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^