Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Molecular analysis of a neurovirulent murine leukemia virus, {\it ts\/}1

ts1 is a neurovirulent spontaneous temperature-sensitive mutant of Moloney murine leukemia virus TB (MoMuLV-TB). MoMuLV-TB causes T-cell lymphoma or lymphoid leukemia in mice after a long latency period whereas ts1 causes a progressive hindlimb paralytic disease after a much shorter latency period. In previous studies, it had been shown that the temperature-sensitive defect resided in the $env$ gene. At the restrictive temperature, the envelope precursor polyprotein, gPr80$\sp{env}$, is inefficiently processed intracellularly into a heterodimer consisting of two cleavage products, gp70 and Prp15E. This inefficient processing is correlated with neurovirulence. In this study, the nucleotide sequences of the env genes for both ts1 and MoMuLV-TB were determined, and the encoded amino acid sequences were deduced from the DNA sequences. There were four unique amino acid substitutions in the gPr80$\sp{env}$ of ts1. In order to determine which unique amino acid was responsible for the phenotypic characteristics of ts1, a set of hybrid genomes was constructed by exchanging restriction fragments between ts1 and MoMuLV-TB. NIH 3T3 cells were transfected with the hybrid genomes to obtain infectious hybrid viruses. Assays of the hybrid viruses showed that a Val-25$\to$Ile substitution in gPr80$\sp{env}$ was responsible for the temperature sensitivity, inefficient processing, and neurovirulence of ts1. In further studies, the Ile-25 in gPr80$\sp{env}$ was substituted with Thr, Ala, Leu, Gly, and Glu by site-directed mutagenesis to generate a new set of mutant viruses, i.e., ts1-T, -A, -L, -G, and -E, respectively. The rank order of the mutants for temperature sensitivity was: ts1-E $>$ ts1-G $>$ ts1-L $>$ ts1-A $>$ ts1 $>$ ts1-T. The degree of temperature sensitivity of each of the mutants also correlated with the degree of inefficient processing of gPr80$\sp{env}$. The mutant viruses were assayed for neurovirulence. ts1-T caused whole body tremor, ts1-A caused hindlimb paralysis, ts1-L caused paraparesis, but ts1-G and -E were not neurovirulent. These results show that inefficient processing of gPr80$\sp{env}$ is correlated with neurovirulence, but if processing of gPr80$\sp{env}$ is too inefficient there is no neurovirulence. Furthermore, the disease profile of each of the neurovirulent viruses depends on the degree of inefficient processing of gPr80$\sp{env}$. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

2-methylthio-N$\sp6$-dimethylallyl modification of adenosine 37 of tRNAs in {\it Escherichia coli\/} K-12

The hypermodified, hydrophobic 2-methylthio-N$\sp6$-(dimethylallyl)-adenosine (ms${2{\cdot}6}\atop1$A) residue occurs $3\sp\prime$ to the anticodon in tRNA species that read codons beginning with U. The first step (i$\sp6$A37 formation) of this modification is catalyzed by dimethylallyl diphosphate:tRNA dimethyallyltransferase (EC 2.5.1.8), which is the product of the miaA gene. Subsequent steps were proposed to be catalyzed by MiaB and MiaC enzymes to complete the ms${2{\cdot}6}\atop1$A37 modification. The study of functions of the ms${2{\cdot}6}\atop1$A37 is very important because this modified base is one of the best candidates for a role in global control in response to environmental stress. This dissertation describes the further delineation of functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli K-12 cells. This work provides significant information on functions of tRNA modifications in E. coli cells to adapt to stressful environmental conditions. Three hypotheses were tested in this work.^ The first hypothesis tested was that non-optimal translation processes cause increased spontaneous mutagenesis by the induction of SOS response in starving cells. To test this hypothesis, I measured spontaneous mutation rates of wild type cells and various mutant strains which are defective in tRNA modification, SOS response, or oxidative damage repair. I found that the miaA mutation acts as a mutator that increased Lac$\sp+$ reversion rates and Trp$\sp+$ reversion frequencies of the wild-type cells in starving conditions. However, the lexA3(Ind)(which abolishes the induction of SOS response) mutation abolished the mutator phenotype of the miaA mutant. The recA430 mutation, not other identified SOS genes, decreased the Lac$\sp+$ reversion to a less extent than that of the lexA3(Ind) mutation. These results suggest that RecA together with another unidentified SOS gene product are responsible for the process.^ The second hypothesis tested was that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ molecules in form of a protein dimer. To test this hypothesis, three versions of the MiaA protein and seven species of tRNA substrates were purified. Binding studies by gel mobility shift assays, filter binding assays and gel filtration shift assays support the hypothesis that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ as a protein dimer but as a monomer to the anticodon stem-and-loop. These results were further supported by using steady state enzyme kinetic studies.^ The third hypothesis tested in this work was that the miaB gene in E. coli exists and is clonable. The miaB::Tn10dCm insertion mutation of Salmonella typhimurium was transduced to E. coli K-12 cells by using P$\sb1$ and P$\sb{22}$ bacteriophages. The insertion was confirmed by HPLC analyses of nucleotide profiles of miaB mutants of E. coli. The insertion mutation was cloned and DNA sequences adjacent to the transposon were sequenced. These DNA sequences were 86% identical to the f474 gene at 14.97 min chromosome of E. coli. The f474 gene was then cloned by PCR from the wild-type chromosome of E. coli. The recombinant plasmid complemented the mutant phenotype of the miaB mutant of E. coli. These results support the hypothesis that the miaB gene of E. coli exists and is clonable. In summary, functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli cells are further delineated in this work in perspectives of adaptation to stressful environmental conditions and protein:tRNA interaction. (Abstract shortened by UMI.) ^

VERIFICATION OF DNA PREDICTED PROTEIN SEQUENCES BY ENZYME HYDROLYSIS AND MASS SPECTROMETRIC ANALYSIS

The focus of this thesis lies in the development of a sensitive method for the analysis of protein primary structure which can be easily used to confirm the DNA sequence of a protein's gene and determine the modifications which are made after translation. This technique involves the use of dipeptidyl aminopeptidase (DAP) and dipeptidyl carboxypeptidase (DCP) to hydrolyze the protein and the mass spectrometric analysis of the dipeptide products.^ Dipeptidyl carboxypeptidase was purified from human lung tissue and characterized with respect to its proteolytic activity. The results showed that the enzyme has a relatively unrestricted specificity, making it useful for the analysis of the C-terminal of proteins. Most of the dipeptide products were identified using gas chromatography/mass spectrometry (GC/MS). In order to analyze the peptides not hydrolyzed by DCP and DAP, as well as the dipeptides not identified by GC/MS, a FAB ion source was installed on a quadrupole mass spectrometer and its performance evaluated with a variety of compounds.^ Using these techniques, the sequences of the N-terminal and C-terminal regions and seven fragments of bacteriophage P22 tail protein have been verified. All of the dipeptides identified in these analysis were in the same DNA reading frame, thus ruling out the possibility of a single base being inserted or deleted from the DNA sequence. The verification of small sequences throughout the protein sequence also indicates that no large portions of the protein have been removed after translation. ^

DNA incisions stimulate genetic instability of triplet repeat sequences related to human hereditary neurological diseases

The molecular mechanisms responsible for the expansion and deletion of trinucleotide repeat sequences (TRS) are the focus of our studies. Several hereditary neurological diseases including Huntington's disease, myotonic dystrophy, and fragile X syndrome are associated with the instability of TRS. Using the well defined and controllable model system of Escherichia coli, the influences of three types of DNA incisions on genetic instability of CTG•CAG repeats were studied: DNA double-strand breaks (DSB), single-strand nicks, and single-strand gaps. The DNA incisions were generated in pUC19 derivatives by in vitro cleavage with restriction endonucleases. The cleaved DNA was then transformed into E. coli parental and mutant strains. Double-strand breaks induced deletions throughout the TRS region in an orientation dependent manner relative to the origin of replication. The extent of instability was enhanced by the repeat length and sequence (CTG•CAG vs. CGG•CCG). Mutations in recA and recBC increased deletions, mutations in recF stabilized the TRS, whereas mutations in ruvA had no effect. DSB were repaired by intramolecular recombination, versus an intermolecular gene conversion or crossover mechanism. 30 nt gaps formed a distinct 30 nt deletion product, whereas single strand nicks and gaps of 15 nts did not induce expansions or deletions. Formation of this deletion product required the CTG•CAG repeats to be present in the single-stranded region and was stimulated by E. coli DNA ligase, but was not dependent upon the RecFOR pathway. Models are presented to explain the DSB induced instabilities and formation of the 30 nucleotide deletion product. In addition to the in vitro creation of DSBs, several attempts to generate this incision in vivo with the use of EcoR I restriction modification systems were conducted. ^

DOUBLE-STRAND BREAK REPAIR PATHWAYS IN DNA STRUCTURE-INDUCED GENETIC INSTABILITY

Genetic instability in mammalian cells can occur by many different mechanisms. In the absence of exogenous sources of DNA damage, the DNA structure itself has been implicated in genetic instability. When the canonical B-DNA helix is naturally altered to form a non-canonical DNA structure such as a Z-DNA or H-DNA, this can lead to genetic instability in the form of DNA double-strand breaks (DSBs) (1, 2). Our laboratory found that the stability of these non-B DNA structures was different in mammals versus Escherichia coli (E.coli) bacteria (1, 2). One explanation for the difference between these species may be a result of how DSBs are repaired within each species. Non-homologous end-joining (NHEJ) is primed to repair DSBs in mammalian cells, while bacteria that lack NHEJ (such as E.coli), utilize homologous recombination (HR) to repair DSBs. To investigate the role of the error-prone NHEJ repair pathway in DNA structure-induced genetic instability, E.coli cells were modified to express genes to allow for a functional NHEJ system under different HR backgrounds. The Mycobacterium tuberculosis NHEJ sufficient system is composed of Ku and Ligase D (LigD) (3). These inducible NHEJ components were expressed individually and together in E.coli cells, with or without functional HR (RecA/RecB), and the Z-DNA and H-DNA-induced mutations were characterized. The Z-DNA structure gave rise to higher mutation frequencies compared to the controls, regardless of the DSB repair pathway(s) available; however, the type of mutants produced after repair was greatly dictated on the available DSB repair system, indicated by the shift from 2% large-scale deletions in the total mutant population to 24% large-scale deletions when NHEJ was present (4). This suggests that NHEJ has a role in the large deletions induced by Z-DNA-forming sequences. H-DNA structure, however, did not exhibit an increase in mutagenesis in the newly engineered E.coli environment, suggesting the involvement of other factors in regulating H-DNA formation/stability in bacterial cells. Accurate repair by established DNA DSB repair pathways is essential to maintain the stability of eukaryotic and prokaryotic genomes and our results suggest that an error-prone NHEJ pathway was involved in non-B DNA structure-induced mutagenesis in both prokaryotes and eukaryotes.

Agrobacterium ParA/MinD-like VirC1 spatially coordinates early conjugative DNA transfer reactions.

Agrobacterium tumefaciens translocates T-DNA through a polar VirB/D4 type IV secretion (T4S) system. VirC1, a factor required for efficient T-DNA transfer, bears a deviant Walker A and other sequence motifs characteristic of ParA and MinD ATPases. Here, we show that VirC1 promotes conjugative T-DNA transfer by stimulating generation of multiple copies per cell of the T-DNA substrate (T-complex) through pairwise interactions with the processing factors VirD2 relaxase, VirC2, and VirD1. VirC1 also associates with the polar membrane and recruits T-complexes to cell poles, the site of VirB/D4 T4S machine assembly. VirC1 Walker A mutations abrogate T-complex generation and polar recruitment, whereas the native protein recruits T-complexes to cell poles independently of other polar processing factors (VirC2, VirD1) or T4S components (VirD4 substrate receptor, VirB channel subunits). We propose that A. tumefaciens has appropriated a progenitor ParA/MinD-like ATPase to promote conjugative DNA transfer by: (i) nucleating relaxosome assembly at oriT-like T-DNA border sequences and (ii) spatially positioning the transfer intermediate at the cell pole to coordinate substrate-T4S channel docking.

Models of DNA sequence evolution

Models of DNA sequence evolution and methods for estimating evolutionary distances are needed for studying the rate and pattern of molecular evolution and for inferring the evolutionary relationships of organisms or genes. In this dissertation, several new models and methods are developed.^ The rate variation among nucleotide sites: To obtain unbiased estimates of evolutionary distances, the rate heterogeneity among nucleotide sites of a gene should be considered. Commonly, it is assumed that the substitution rate varies among sites according to a gamma distribution (gamma model) or, more generally, an invariant+gamma model which includes some invariable sites. A maximum likelihood (ML) approach was developed for estimating the shape parameter of the gamma distribution $(\alpha)$ and/or the proportion of invariable sites $(\theta).$ Computer simulation showed that (1) under the gamma model, $\alpha$ can be well estimated from 3 or 4 sequences if the sequence length is long; and (2) the distance estimate is unbiased and robust against violations of the assumptions of the invariant+gamma model.^ However, this ML method requires a huge amount of computational time and is useful only for less than 6 sequences. Therefore, I developed a fast method for estimating $\alpha,$ which is easy to implement and requires no knowledge of tree. A computer program was developed for estimating $\alpha$ and evolutionary distances, which can handle the number of sequences as large as 30.^ Evolutionary distances under the stationary, time-reversible (SR) model: The SR model is a general model of nucleotide substitution, which assumes (i) stationary nucleotide frequencies and (ii) time-reversibility. It can be extended to SRV model which allows rate variation among sites. I developed a method for estimating the distance under the SR or SRV model, as well as the variance-covariance matrix of distances. Computer simulation showed that the SR method is better than a simpler method when the sequence length $L>1,000$ bp and is robust against deviations from time-reversibility. As expected, when the rate varies among sites, the SRV method is much better than the SR method.^ The evolutionary distances under nonstationary nucleotide frequencies: The statistical properties of the paralinear and LogDet distances under nonstationary nucleotide frequencies were studied. First, I developed formulas for correcting the estimation biases of the paralinear and LogDet distances. The performances of these formulas and the formulas for sampling variances were examined by computer simulation. Second, I developed a method for estimating the variance-covariance matrix of the paralinear distance, so that statistical tests of phylogenies can be conducted when the nucleotide frequencies are nonstationary. Third, a new method for testing the molecular clock hypothesis was developed in the nonstationary case. ^

REPSA: A method for determining the sequence specificity of DNA binding ligands

We developed a novel combinatorial method termed restriction endonuclease protection selection and amplification (REPSA) to identify consensus binding sites of DNA-binding ligands. REPSA uses a unique enzymatic selection based on the inhibition of cleavage by a type IIS restriction endonuclease, an enzyme that cleaves DNA at a site distal from its recognition sequence. Sequences bound by a ligand are protected from cleavage while unprotected sequences are cleaved. This enzymatic selection occurs in solution under mild conditions and is dependant only on the DNA-binding ability of the ligand. Thus, REPSA is useful for a broad range of ligands including all classes of DNA-binding ligands, weakly binding ligands, mixed populations of ligands, and unknown ligands. Here I describe REPSA and the application of this method to select the consensus DNA-binding sequences of three representative DNA-binding ligands; a nucleic acid (triplex-forming single-stranded DNA), a protein (the TATA-binding protein), and a small molecule (Distamycin A). These studies generated new information regarding the specificity of these ligands in addition to establishing their DNA-binding sequences. ^

COMPARISON OF DNA TRANSFECTION AND MICROCELL-MEDIATED CHROMOSOME TRANSFER FOR DETECTING TRANSFORMING GENES IN HUMAN TUMOR CELL LINES

DNA mediated gene transfection is an important tool for moving and isolating genes from one cell type and putting them into a foreign genetic background. DNA transfection studies have been done routinely in many laboratories to identify and isolate transforming sequences in human tumors and tumor cell lines. A second technique, microcell-mediated chromosome transfer, allows the transfer of small numbers of intact human chromosome from one cell to another. This work was done to compare the efficiency of these two techniques in the transformation of NIH 3T3 mouse fibroblast cells.^ My intent in comparing these two techniques was to see if there was a difference in the transforming capability of DNA which has been purified of all associated protein and RNAs, and that of DNA which is introduced into a cell in its native form, the chromosome. If chromosomal sequences were capable of transforming the 3T3 cells in culture, the method could then be used as a way to isolate the relevant tumorigenic chromosomes from human tumors.^ The study shows, however, that even for those cell lines that contain transforming sequences identified by DNA-mediated gene transfer, those same sequences were unable to transform 3T3 cells when introduced to the cells by somatic fusion of human tumor microcells. I believe that the human transforming sequences in their original genetic conformation are not recognized by the mouse cell as genes which should be expressed; therefore, no noticeable transformation event was selected by this technique. ^

Global patterns of DNA polymorphism in noncoding regions in human populations

DNA sequence variation is currently a major source of data for studying human origins, evolution, and demographic history, and for detecting linkage association of complex diseases. In this dissertation, I investigated DNA variation in worldwide populations from two ∼10 kb autosomal regions on 22q11.2 (noncoding) and 1q24 (introns). A total of 75 variant sites were found among 128 human sequences in the 22q11.2 region, yielding an estimate of 0.088% for nucleotide diversity (π), and a total of 52 variant sites were found among 122 human sequences in the 1q24 region with an estimated π value of 0.057%. The data from these two regions and a 10 kb noncoding region on Xq13.3 all show a strong excess of low-frequency variants in comparison to that expected from an equilibrium population, indicating a relatively recent population expansion. The effective population sizes estimated from the three regions were 11,000, 12,700, and 8,600, respectively, which are close to the commonly used value of 10,000. In each of the two autosomal regions, the age of the most recent common ancestor (MRCA) was estimated to be older than 1 million years among all the sequences and ∼600,000 years among non-African sequences, providing first evidence from autosomal noncoding or intronic regions for a genetic history of humans much more ancient than the emergence of modern humans. The ancient genetic history of humans indicates no severe bottleneck during the evolution of humans in the last half million years; otherwise, much of the ancient genetic history would have been lost during a severe bottleneck. This study strongly suggests that both the “out of Africa” and the multiregional models are too simple for explaining the evolution of modern humans. A compilation of genome-wide data revealed that nucleotide diversity is highest in autosomal regions, intermediate in X-linked regions, and lowest in Y-linked regions. The data suggest the existence of background selection or selective sweep on Y-linked loci. In general, the nucleotide diversity in humans is low compared to that in chimpanzee and Drosophila populations. ^