33 resultados para Cis-acting Elements
Resumo:
Myxococcus xanthus is a Gram-negative soil bacterium that undergoes multicellular development when high-density cells are starved on a solid surface. Expression of the 4445 gene, predicted to encode a periplasmic protein, commences 1.5 h after the initiation of development and requires starvation and high density conditions. Addition of crude or boiled supernatant from starving high-density cells restored 4445 expression to starving low-density cells. Addition of L-threonine or L-isoleucine to starving low-density cells also restored 4445 expression, indicating that the high-density signaling activity present in the supernatant might be composed of extracellular amino acids or small peptides. To investigate the circuitry integrating these starvation and high-density signals, the cis- and trans-acting elements controlling 4445 expression were identified. The 4445 transcription start site was determined by primer extension analysis to be 58 by upstream of the predicted translation start site. The promoter region contained a consensus sequence characteristic of e&barbelow;xtrac&barbelow;ytoplasmic f&barbelow;unction (ECF) sigma factor-dependent promoters, suggesting that 4445 expression might be regulated by an ECF sigma factor-dependent pathway, which are known to respond to envelope stresses. The small size of the minimum regulatory region, identified by 5′-end deletion analysis as being only 66 by upstream of the transcription start site, suggests that RNA polymerase could be the sole direct regulator of 4445 expression. To identify trans-acting negative regulators of 4445 expression, a strain containing a 4445-lacZ was mutagenized using the Himar1-tet transposon. The four transposon insertions characterized mapped to an operon encoding a putative ECF sigma factor, ecfA; an anti-sigma factor, reaA; and a negative regulator, reaB. The reaA and the reaB mutants expressed 4445 during growth and development at levels almost 100-fold higher than wild type, indicating that these genes encode negative regulators. The ecfA mutant expressed 4445-lacZ at basal levels, indicating that ecfA is a positive regulator. High Mg2+ concentrations over-stimulated this ecfA pathway possibly due to the depletion of exopolysaccharides and assembled type IV pili. These data indicate that the ecfA operon encodes a new regulatory stress pathway that integrates and transduces starvation and cell density cues during early development and is also responsive to cell-surface alterations.^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Enterococcus faecalis is a Gram-positive bacterium that lives as a commensal organism in the mammalian gastrointestinal tract, but can behave as an opportunistic pathogen. Our lab discovered that mutation of the eutK gene attenuates virulence of E. faecalis in the C. elegans model host. eutK is part of the ethanolamine metabolic pathway which was previously unknown in E. faecalis. I discovered the presence of two unique posttranscriptional regulatory features that control expression of eut locus genes. The first feature I found is an AdoCBL riboswitch, a cis-acting RNA regulatory element that acts as a positive regulator of gene expression. The second feature I discovered is a unique two-component system, EutVW. The EutV response regulator contains an ANTAR family domain, which binds RNA to trigger transcriptional antitermination. I determined that induction of expression of several genes in the eut locus is dependent on ethanolamine, AdoCBL and the two-component system. AdoCBL and ethanolamine are both required for induction of eut locus gene expression. Additionally, I discovered eutG is regulated by a unique mechanism of antitermination. Both the AdoCBL riboswitch and EutV response regulator control the expression of the downstream gene eutG. EutV potentially acts through a novel antitermination mechanism in which a dimer of EutV binds to a pair of mRNA stem loops forming an antitermination complex. My data show a unique mechanism by which two environmental signals are integrated by two different posttranscriptional regulators to regulate a single locus.
Resumo:
Revertants of a colcemid-resistant Chinese hamster ovary cell line with an altered (D45Y) beta-tubulin have allowed the identification of four cis-acting mutations (L187R, Y398C, a 12-amino acid in-frame deletion, and a C-terminal truncation) that act by destabilizing the mutant tubulin and preventing it from incorporating into microtubules. These unstable beta-tubulins fail to form heterodimers and are predominantly found in association with the chaperonin CCT, suggesting that they cannot undergo productive folding. In agreement with these in vivo observations, we show that the defective beta-tubulins do not stably interact with cofactors involved in the tubulin folding pathway and, hence, fail to exchange with beta-tubulin in purified alphabeta heterodimers. Treatment of cells with MG132 causes an accumulation of the aberrant tubulins, indicating that improperly folded beta-tubulin is degraded by the proteasome. Rapid degradation of the mutant tubulin does not elicit compensatory changes in wild-type tubulin synthesis or assembly. Instead, loss of beta-tubulin from the mutant allele causes a 30-40% decrease in cellular tubulin content with no obvious effect on cell growth or survival.
Resumo:
Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.
Resumo:
MuSVts110 is a conditionally defective mutant of Moloney murine sarcoma virus which undergoes a novel tmperature-dependent splice event at growth temperatures of 33$\sp\circ$C or lower. Relative to wild-type MuSV-124, MuSVts110 contains a 1487 base deletion spanning from the 3$\sp\prime$ end of the p30 gag coding region to just downstream of the first v-mos initiation codon. As a result, the gag and mos genes are fused out of frame and no v-mos protein is expressed. However, upon a shift to 33$\sp\circ$C or lower, a splice event occurs which removes 431 bases, realigns the gag and mos genes, and allows read-through translation of a P85gag-mos transforming protein. Interestingly, while the cryptic splice sites utilized in MuSVts110 are present and unaltered in MuSV-124, they are never used. Due to the 1487 base deletion, the MuSV-124 intron was reduced from 1919 to 431 bases suggesting that intron size might be involved in the activation of these cryptic splice sites in MuSVts110. Since the splicing phenotype of the MuSVts110 equivalent (TS32 DNA) which contains the identical 1487 base deletion introduced into otherwise wild-type MuSV-124 DNA, was indistinguishable from authentic MuSVts110, it was concluded that this deletion alone is responsible for activation of the cryptic splice sites used in MuSVts110. These results also confirmed that thermodependent splicing is an intrinsic property of the viral RNA and not due to some cellular defect. Furthermore, analysis of gag gene deletion and frameshift MuSVts110 mutants demonstrated that viral gag gene proteins do not play a role in regulation of MuSVts110 splicing. Instead, cis-acting viral sequences appear to mediate regulation of the splice event.^ Our initial observation that truncation of the MuSVts110 transcript, leaving only residual amounts of the flanking exon sequences, completely abolished splicing activity argued that exon sequences might participate in the regulation of the splice event.^ Analysis of exon sequence involvement has also identified cis-acting sequences important in the thermodependence of the splice event. Data suggest that regulation of the MuSVts110 splice event involves multiple interactions between specific intron and exon sequences and spliceosome components which together limit splicing activity to temperatures of 33$\sp\circ$C or lower while simultaneously restricting splicing to a maximum of 50% efficiency. (Abstract shortened with permission of author.) ^
Resumo:
We have developed a novel way to assess the mutagenicity of environmentally important metal carcinogens, such as nickel, by creating a positive selection system based upon the conditional expression of a retroviral transforming gene. The target gene is the v-mos gene in MuSVts110, a murine retrovirus possessing a growth temperature dependent defect in expression of the transforming gene due to viral RNA splicing. In normal rat kidney cells infected with MuSVts110 (6m2 cells), splicing of the MuSVts110 RNA to form the mRNA from which the transforming protein, p85$\sp{\rm gag-mos}$, is translated is growth-temperature dependent, occurring at 33 C and below but not at 39 C and above. This splicing "defect" is mediated by cis-acting viral sequences. Nickel chloride treatment of 6m2 cells followed by growth at 39 C, allowed the selection of "revertant" cells which constitutively express p85$\sp{\rm gag-mos}$ due to stable changes in the viral RNA splicing phenotype, suggesting that nickel, a carcinogen whose mutagenicity has not been well established, could induce mutations in mammalian genes. We also show by direct sequencing of PCR-amplified integrated MuSVts110 DNA from a 6m2 nickel-revertant cell line that the nickel-induced mutation affecting the splicing phenotype is a cis-acting 70-base duplication of a region of the viral DNA surrounding the 3$\sp\prime$ splice site. These findings provide the first example of the molecular basis for a nickel-induced DNA lesion and establish the mutagenicity of this potent carcinogen. ^
Resumo:
The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^
Resumo:
The initial step in coronavirus-mouse hepatitis virus (MHV) replication is the synthesis of negative strand RNA from a positive strand genomic RNA template. Our approach to studying MHV RNA replication is to identify the cis-acting signals for RNA synthesis and the protein(s) which recognizes these signals at the 3$\sp\prime$ end of genomic RNA of MHV. To determine whether host cellular and/or virus-specific proteins interact with the 3$\sp\prime$ end of the coronavirus genome, an RNase T$\sb1$ protection/gel mobility shift electrophoresis assay was used to examine cytoplasmic extracts from either mock- or MHV-JHM-infected 17Cl-1 murine cells for the ability to form complexes with defined regions of the genomic RNA. A conserved 11 nucleotide sequence UGAAUGAAGUU at nucleotide positions 36 to 26 from the 3$\sp\prime$ end of genomic RNA was identified to be responsible for the specific binding of host proteins, by using a series of RNA probes with deletions and mutations in this region. The RNA probe containing the 11 nucleotide sequence bound approximately four host cellular proteins with a highly labeled 120 kDa and three minor species with sizes of 103, 81 and 55 kDa, assayed by UV-induced covalent cross-linking. Mutation of the 11 nucleotide motif strongly inhibited cellular protein binding, and decreased the amount of the 103 and 81 kDa proteins in the complex to undetectable levels and strongly reduced the binding of the 120 kDa protein. Less extensive mutations within this 11 nucleotide motif resulted in variable decreases in RNA-protein complex formation depending on each probe tested. The RNA-protein complexes observed with cytoplasmic extracts from MHV-JHM-infected cells in both RNase protection/gel mobility shift and UV cross-linking assays were indistinguishable to those observed with extracts from uninfected cells.^ To investigate the possible role of this 3$\sp\prime$ protein binding element in viral RNA replication in vivo, defective interfering RNA molecules with complete or partial mutations of the 11 nucleotide conserved sequence were transcribed in vitro, transfected to host 17Cl-1 cells in the presence of helper virus MHV-JHM and analyzed by agarose gel electrophoresis, competitive RT-PCR and direct sequencing of the RT-PCR products. Both negative strand synthesis and positive strand replication of DI RNA were affected by mutation that disrupts RNA-protein complex formation, even though the 11 mutated nucleotides were converted to wild type sequence, presumably by recombination with helper virus. Kinetic analysis indicated that recombination between DI RNA and helper virus occurred 5.5 to 7.5 hours post infection when replication of positive strand DI RNA was barely observed. Replication of positive strand DI RNAs carrying partial mutations within the 11 nucleotide motif was dependent upon recombination events after transfection. Replication was strongly inhibited when reversion to wild type sequence did not occur, and after recombination, reached similar levels as wild type DI RNA. A DI RNA with mutation upstream of the protein binding motif replicated as efficiently as wild type without undergoing recombination. Thus the conserved 11 nucleotide host protein binding motif appears to play an important role in viral RNA replication. ^
Resumo:
Epidemiological studies have shown cadmium to induce cancer in humans, while experimental studies have proven this metal to be a potent tumor inducer in animals. However, cadmium appears nonmutagenic in most prokaryotic and eukaryotic mutagenesis assays. In this study, we present the identification of mutations in normal rat kidney cells infected with the mutant MuSVts110 retrovirus (6m2 cells) as a result of treatment with cadmium chloride. The detection of these mutations was facilitated by the use of a novel mutagenesis assay established in this laboratory. The 6m2 reversion assay is a positive selection system based on the conditional expression of the MuSVts110 v-mos gene. In MuSVts110 the gag and mos genes are fused out of frame, thus the translation of the v-mos sequence requires a frameshift in the genomic RNA. In 6m2 cells this frameshift is accomplished by the temperature-dependent splicing of the primary MuSVts110 transcript. Splicing of MuSVts110, which is mediated by cis-acting sequences, occurs when 6m2 cells are grown at 33$\sp\circ$C and below, but not at 39$\sp\circ$C. Therefore, 6m2 cells appear transformed at low growth temperatures, but take on a morphologically normal appearance when grown at high temperatures. The treatment of 6m2 cells with cadmium chloride resulted in the outgrowth of a number of cells that reverted to the transformed state at high growth temperatures. Analysis of the viral proteins expressed in these cadmium-induced 6m2 revertants suggested that they contained mutations in their MuSVts110 DNA. Sequencing of the viral DNA from three revertants that constitutively expressed the P85$\sp{gag{-}mos}$ transforming protein revealed five different mutations. The Cd-B2 revertant contained three of those mutations: an A-to-G transition 48 bases downstream of the MuSVts110 3$\sp\prime$ splice site, plus a G-to-T and an A-to-T transversion 84 and 100 bases downstream of the 5$\sp\prime$ splice site, respectively. The Cd-15-5 revertant also contained a point mutation, a T-to-C transition 46 bases downstream of the 5$\sp\prime$ splice site, while Cd-10-5 contained a three base deletion of MuSVts110 11 bases upstream of the 3$\sp\prime$ splice site. A fourth revertant, Cd-10, expressed a P100$\sp{gag{-}mos}$ transforming protein, and was found to have a two base deletion. This deletion accomplished the frameshift necessary for v-mos expression, but did not alter MuSVts110 RNA splicing and the expression of p85$\sp{gag{-}mos}.$ Lastly, sequencing of the MuSVts110 DNA from three spontaneous revertants revealed the same G to T transversion in each one. This was the same mutation that was found in the Cd-B2 revertant. These findings provide the first example of mutations resulting from exposure to cadmium and suggest, by the difference in each mutation, the complexity of the mechanism utilized by cadmium to induce DNA damage. ^
Resumo:
The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^
Resumo:
As the major anionic phospholipids predominantly found in the mitochondrial inner membrane of eukaryotic cells, cardiolipin (CL) and its precursor phosphatidylglycerol (PG) are of great importance in many critical mitochondrial processes. Pgs1Δ cells of Saccharomyces cerevisiae lacking both PG and CL display severe mitochondrial defects. Translation of several proteins including products of four mitochondrial DNA (mtDNA) encoded genes (COX1, COX2, COX3, and COB ) and one nuclear-encoded gene (COX4) is inhibited. The molecular basis of this phenotype was analyzed using a combined biochemical, molecular and genetic approach. ^ Using a mitochondrial targeted green fluorescence protein (mtGFP) fused to the COX4 promoter and its 5′ and 3′ untranslated regions (UTRs), lack of mtGFP expression independent of carbon source and strain background was confirmed to be at the translational level. The translational defect was not due to deficiency of mitochondrial respiratory function but rather caused directly by the lack of PG/CL in the mitochondrial membrane. Re-introduction of a functional PGS1 gene restored PG synthesis and expression of the above mtGFP. Deletional analysis of the 5′ UTR of COX4 mRNA revealed the presence of a 50 nt sequence as a cis-acting element inhibiting COX4 translation. Using similar constructs with HIS3 and lacZ as reporter genes, extragenic spontaneous mutations that allowed expression of His3p and β-galactosidase were isolated, which appeared to be recessive and derived from loss-of-function mutations as determined by mating analysis. Using a tetracycline repressible plasmid-borne PGS1 expression system and an in vivo mitochondrial protein translation method, the translation of mtDNA encoded COX1 and COX3 mRNAs was shown to be significantly inhibited in parallel with reduced levels of PG/CL content. Therefore, the cytoplasmic translation machinery appears to be able to sense the level of PG/CL in mitochondria and regulate COX4 translation coordinately with the mtDNA encoded subunits. ^ The essential requirement of PG and CL in mitochondrial function was further demonstrated in the study of CL synthesis by factors affecting mitochondrial biogenesis such as carbon source, growth phase or mitochondrial mutations at the level of transcription. We have also demonstrated that CL synthesis is dependent on the level of PG and INO2/INO4 regulatory genes. ^
Resumo:
Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^
Resumo:
Viral systems have contributed tremendously to the understanding of eukaryotic molecular biology. The proportional pattern of retroviral RNA expression offers many clues into the alternative splicing of cellular transcripts. The MuSVts110 virus presents an unusual expression system, where the mechanistic combination of RNA splicing and cellular transformation can be physiologically manipulated. Splicing of MuSVts110 pre-mRNA occurs inefficiently (30%-50%) at 33$\sp\circ$C or below and is subdued at 39$\sp\circ$C ($<$5%). Like most alternatively spliced cellular and retroviral transcripts, the MuSVts110 pre-mRNA contains cis-acting intron and exon sequences that attenuate splicing. These include a splicing inhibitory sequence at the 3$\prime$ end of the MuSVts110 v-mos exon, called the E2 Distal Element (E2DE), and a sub-optimal 3$\prime$ splice site. The E2DE directly inhibits MuSVts110 RNA splicing in a sequence-specific fashion at 39$\sp\circ$C but not at 28$\sp\circ$C, potentially through the association of cellular factors. Inefficient MuSVts110 splicing is pre-dominantly attributed to the utilization of multiple weak branchpoint sequences located between $-113$ and $-34$ nucleotides upstream of the 3$\prime$ splice site. The molecular control of MuSVts110 splicing, represented primarily by scattered multiple inefficient branchpoint sequences that are conditionally modulated by the E2DE at higher growth temperatures, is discussed. ^
Resumo:
AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^