101 resultados para Extraction method

em Reposit


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this paper was to apply a multiresidue method using Supercritical Fluid Extraction (SFE) and capillary gas chromatography with electron capture and mass spectrometry detections in the analysis of the levels of pesticide residues in fruits and vegetables. Single laboratory validation of both solid-liquid and supercritical fluid extraction methods was carried out for 32 compounds selected from four pesticide classes (organochlorine, organonitrogen, organophosphorus and pyretroid) in blank and fortified samples of fresh lettuce, potato, apple and tomato. Recoveries for the majority of pesticides from fortified samples at fortification level of 0.04-0.10 mg kg -1 ranged 74-96% for both methods and confirmation of pesticide identity was performed by gas-chromatography-mass spectrometry in a selected-ion monitoring mode. Both methods showed good limits of detection (less 0.01 mg kg-1, depending on the pesticide and matrix) and the SFE method minimized environmental concerns, time, and laboratory work. ©2005 Sociedade Brasileira de Química.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

70.00% 70.00%

Publicador:

Resumo:

This work has been developed using a sylvestral fruit tree, native to the Brazilian forest, the Eugenia uniflora L., one of the Mirtaceae family. The main goal of the analytical study was focused on extraction methods themselves. The method development pointed to the Clevenger extraction as the best yield in relation to SFE and Soxhlet. The SFE method presented a good yield but showed a big amount of components in the final extract, demonstrating low selectivity. The essential oil extracted was analyzed by GC/FID showing a large range of polarity and boiling point compounds, where linalool, a widely used compound, was identified. Furthermore, an analytical solid phase extraction method was used to clean it up and obtain separated classes of compounds that were fractionated and studied by GC/FlD and GUMS. (c) 2006 Elsevier B.V. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

A simultaneous method for the trace determination of acidic, neutral herbicides and their transformation products in estuarine waters has been developed through an on-line solid-phase extraction method followed by liquid chromatography with diode array and mass spectrometric detection. An atmospheric pressure chemical ionization (APCI) interface was used in the negative ionization mode after optimization of the main APCI parameters. Limits of detection ranged from 0.1 to 0.02 ng/ml for 50 mi of acidified estuarine waters preconcentrated into polymeric precolumns and using time-scheduled selected ion monitoring mode. Two degradation products of the acidic herbicides (4-chloro-2-methylphenol and 2,4-dichlorophenol) did not show good signal response using APCI-MS at the concentration studied due to the higher fragmentor voltage needed for their determination For molinate and the major degradation product of propanil, 3,4-dichloroaniline, positive ion mode was needed for APCI-MS detection. The proposed method was applied to the determination of herbicides in drainage waters from rice fields of the Delta del Ebro (Spain). During the S-month monitoring of the herbicides, 8-hydroxybentazone and 4-chloro-2-methylphenoxyacetic acid were successively found in those samples. (C) 2000 Elsevier B.V. B.V. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

This paper proposes a method to determine iron in samples of fish feed and feces using ultrasound in the extraction of the analyte and in subsequent quantification by flame atomic absorption spectrometry. Using HCl 0.10 mol L -1 as the extraction solution, the optimal conditions of extraction were found to be: granulometry of the sample <60 μm; a sonication time of five cycles of 10 s and sonication power of 136 W. The method was applied in studies of the availability of iron in four food sources used in the diet of Nile Tilapia. The results obtained with the proposed extraction method allowed us to calculate the coefficients of apparent digestibility of iron in the food sources, which was not possible when using results obtained from samples mineralized by acid digestion. © Springer Science+Business Media, LLC 2008.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The study is aimed to evaluate the efficiency of ultrasound-assisted extraction (UAE) as a simple strategy focused on sample preparation for metal determination in biological samples. The extraction of sodium and potassium extraction was carried out from swine feed followed by determination of the concentration of these metals by flame atomic emission spectrometry (FAES). The experiment was performed to cover the study of the variables influencing the extraction process and its optimal conditions (sample mass, particle size, acid concentration, sonication time and ultrasound power); the determination of these analytical characteristics and method validation using certified reference material; and the analysis of pre-starter diets. The optimal conditions established conditions were as follows: mass: 100 mg, particle size:<60 μm, acid concentration: 0.10 mol L-1 HCl, sonication time: 50 s and ultrasound power: 102 W. The proposed method (UAE) was applied in digestibility assays of those nutrients present in different piglet pre-starter feeds and their results proved to be compatible with those obtained from mineralized samples (P < 0.05). The ultrasound extraction method was demonstrated to be an excellent alternative for handless sampling and operational costs and the method also has the advantage of does not generating toxic residues that may negatively affect human health and contaminate the environment. © 2013 Elsevier B.V. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The algorithm creates a buffer area around the cartographic features of interest in one of the images and compare it with the other one. During the comparison, the algorithm calculates the number of equals and different points and uses it to calculate the statistical values of the analysis. One calculated statistical value is the correctness, which shows the user the percentage of points that were correctly extracted. Another one is the completeness that shows the percentage of points that really belong to the interest feature. And the third value shows the idea of quality obtained by the extraction method, since that in order to calculate the quality the algorithm uses the correctness and completeness previously calculated. All the performed tests using this algorithm were possible to use the statistical values calculated to represent quantitatively the quality obtained by the extraction method executed. So, it is possible to say that the developed algorithm can be used to analyze extraction methods of cartographic features of interest, since that the results obtained were promising.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Desenvolveu-se um método rápido para extração de DNA de bactérias, que ao contrário de outros métodos, não requer o uso de enzimas, como lisozima e proteinase K, previamente, utilizado-se o carbonato de silício (carborundum) como agente físico para efetuar a quebrar da parede celular da bactéria. Com este método conseguiu-se extrair DNA bacteriano num menor tempo, além de mais rápido, ele mostrou-se mais simples e econômico, quando comparado aos métodos convencionais. O DNA obtido pode ser utilizado para diversas finalidades relacionadas ao DNA de bactérias, obtendo-se uma quantidade razoável de DNA, que varia de 725 µg/mL a 1170 µg/mL por cada 0,1 g de célula bacteriana, com ótima qualidade.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The work aimed to study the development of Tabebuia chrysotricha Standl. seedlings injunction of different substrate and different fertilization solutions. To compose the substrate it was used fibrous and granulated coconut fiber obtaining the following treatments: S1- 100% fibrous, S2- 60% fibrous and 40% granulated, S3- 40% fibrous and 60% granulated and S4- 100% granulated. The basis fertilization was the same for all treatments and the solutions of fertilization varied in order to obtain solutions with the following electric conductivities: EC1- 1.06 dS m(-1), EC2- 2.12 dS m(-1), EC3- 3.2 dS m(-1) and EC4- 4.25 dS m(-1). The propagative material was sowed directly in plastic containers (120mL) with the respective substrates. The fertilization was received through sub irrigation once a week, until the seedlings reached 20cm of height approximately. The chemical analyses of the substrate (EC and pH), through aqueous extraction method 1:1.5 (1 substrate: 1.5 deionized water), the analyses of aerial part height, stein diameter and pairs true leaves number, as well as the weight of total dry, matter, were accomplished each 15 days. In almost every analysis, the substrate with granulated coconut fiber, as well as the smallest EC (1.06 e 2.12 dS m(-1)) of fertilization solutions,formed seedlings with higher averages, indicating faster growth. In the conditions of this experiment, the production of T. chrysotricha seedlings was better in granulated coconut fiber substrate and fertilizer solutions with EC of 1.06 dS m(-1), appreciating the estimated characteristics.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)