PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Epstein-Barr Virus (EBV) detection and typing by PCR: a contribution to diagnostic screening of EBV-positive Burkitt's lymphoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

PCR Multiplex fluorescente para detecção de bactérias em sêmen bovino

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detection of bovine Herpesvirus type 5 in formalin-fixed, paraffin-embedded bovine brain by PCR: a useful adjunct to conventional tissue-based diagnostic test of bovine encephalitis

The aim of this study was to evaluate the application of PCR technique for the detection of BoHV-5 in routinely formalin-fixed, paraffin-embedded brain tissues in 20 naturally infected calves affected by fatal meningoencephalitis. Brains were divided into two halves, one kept fresh for virus isolation and PCR assay, targeting the glycoprotein C gene from BoHV-5 genome. The other half brain, corresponding to posterior cortex region, was submitted to formalin fixation and embedded into paraffin blocks for microscopic evaluation and total DNA isolation. Most of the slides showed severe multifocal non-supurative encephalitis with neuronal degeneration, neurophagia, and no acidophilic intranuclear inclusions could be found in neurons and glial. The 20 fresh samples were confirmed, by virus isolation and PCR assay, as having the BoHV-5 virus and, respective glicoprotein C sequence, while 15 of 20 formalin-fixed, paraffin-embedded samples were considered positive for the same analysis. The results revealed the first description of PCR efficiency, applied to formalin-fixed, paraffin-embedded brain collected from naturally infected calves, improving the detection of BoHV-5 from archival samples in South America. (c) 2007 Published by Elsevier B.V.

Fluorescent in situ hybridization (FISH) as a diagnostic tool for Williams-Beuren syndrome

Fluorescent in situ hybridization (FISH) with commercial probes covering the elastin gene (ELN) was used to determine the frequency of the 7q11.23 deletion in 18 children clinically diagnosed with Williams-Beuren syndrome (WBS). A de novo deletion was detected in 15 of the children (83%). Diagnostic investigation for WBS started late in childhood (median = 5.8 years). All the children showed facial features typical of the syndrome, mental retardation and developmental delay. Over-friendliness was observed in the majority of cases. Clinodactyly of the 5th finger (n = 13), cardiovascular disease (n = 9), loquacity (n = 9), low birthweight (n = 8), and failure to thrive (n = 9) were observed only in those children with the deletion. Respiratory problems (n = 9), though not previously reported in the literature, was a common finding in the group studied. Our results confirmed that FISH is useful in identifying 7q11.23 deletions in cases of WBS. Clinical manifestations were more evident in the deletion-positive children.

Hemocultura, reação de imunofluorescência indireta (RIFI) e reação em cadeia pela polimerase (PCR) para Leishmania spp. em cães e gatos provenientes de área endêmica e não endêmica para leishmaniose

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação da técnica da reação em cadeia pela polimerase (PCR) no estudo da distribuição do vírus rábico em camundongos Mus musculus inoculados experimentalmente

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Estudo comparativo dos métodos diagnósticos para Leishmaniose Visceral em cães oriundos de Ilha Solteira, SP

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Definition of a diagnostic routine in individuals with inconclusive serology for chagas disease

Despite the existence of highly sensitive tests, inconclusive serological results are frequent in chronic chagasic infection. This study aimed to define a diagnostic conduct for 30 individuals with inconclusive serology (G3) for chagasic infection assisted at the Outpatient Unit for Infectious and Parasitic Diseases of the Botucatu School of Medicine. Twenty-one individuals with negative serology (G1) and 33 with positive serology (G2) were also studied. Serological methods ELISA, HAI, IFI and immunoblotting TESA-cruzi were used for G1, G2 and G3, and parasitological methods xenodiagnosis, hemoculture and PCR-LIT were used for G2 and G3 individuals. ELISA, HAI and IFI were performed in 5 different blood samples in G2 and G3. TESA-cruzi was carried out only once in G1, G2 and G3 and, since it is the most sensitive, it was utilized as standard. In G3, positivity for ELISA reached 86% in the fifth blood sample; the ELISA+HAI+IFI combination showed a maximum of 44.8% in the second sample; and TESA-cruzi, 76% in one single sample. Xenodiagnosis positivity was 9.4%; hemoculture showed 15.2%; and PCR-LIT exhibited 22% positivity in G2. Nevertheless, in G3, positivity percentage was 3.4% for xenodiagnosis, 6.7% for PCR-LIT, and no positive result was found for hemoculture. In G3, PCR-LIT resolved one case which was still inconclusive according to serology tests. In order to define inconclusive diagnoses, the results suggest the combined use of ELISA+HAI+IFI in 2 blood samples, decreasing the occurrence of false positive/negative results. If results remain inconclusive, the performance of TESA-cruzi and PCR-LIT, if necessary, is recommended.

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.

Comparison of agar gel immunodiffusion test, rapid slide agglutination test, microbiological culture and PCR for the diagnosis of canine brucellosis

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)