110 resultados para chloroform
em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Flavonoid-rich Praxelis clematidea (Griseb.) R.M.King & H.Robinson (Asteraceae) is a native plant of South America. This study evaluates the gastroprotective activity and possible mechanisms for both the chloroform (CHCl3P) and ethyl acetate phases (AcOEtP) obtained from aerial parts of the plant. The activity was investigated using acute models of gastric ulcer. Gastric secretion biochemical parameters were determined after pylorus ligature. The participation of cytoprotective factors such as mucus, nitric oxide (NO), sulfhydryl (SH) groups, prostaglandin E2 (PGE 2), reduced glutathione (GSH), superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione reductase (GR), reduction of lipid peroxidation (malondialdehyde level), and polymorphonuclear infiltration (myeloperoxidase activity), was also investigated. CHCl3P (125, 250, and 500 mg/kg) and AcOEtP (62.5, 125, and 250 mg/kg) showed significant gastroprotective activity, reducing the ulcerative index by 75, 83, 88 % and 66, 66, 81 % for ethanol; 67, 67, 56 % and 56, 53, 58 % for a non-steroidal anti-inflammatory drug (NSAID); and 74, 58, 59 % and 64, 65, 61 % for stress-induced gastric ulcer, respectively. CHCl3P (125 mg/kg) and AcOEtP (62.5 mg/kg) significantly reduced the ulcerative area by 78 and 83 %, respectively, for the ischemia-reperfusion model. They also did not alter the biochemical parameters of gastric secretion, the GSH level or the activities of SOD, GPx or GR. They increased the quantity of gastric mucus, not dependent on NO, yet dependent on SH groups, and maintained PGE2 levels. The P. clematidea phases demonstrated gastroprotective activity related to cytoprotective factors. © 2012 The Japanese Society of Pharmacognosy and Springer.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Agaricus blazei Murill is a medicinal mushroom native to Brazil. The present work assessed the clastogenic and anticlastogenic potential of organic extracts (ethanol and chloroform/methanol) from the lineage AB97/11 in chinese hamster CHO-K-1 (wild type) and CHO-xrs5 (repair deficient) cells using the chromosome aberration (CA) and sister chromatid exchange (SCE) assays. In these experimental conditions were observed: (a) anticlastogenic effect at concentrations of 0.06 and 0.09% of the EtOH extract and at the 0.03 and 0.06% concentrations of the C/MetOH extract in CHO-K-1; (b) absence of protector effect on CHO-xrs5 cells; and (c) absence of protector effect in the SCE assay. These results indicate that organic extracts of A. blazei lineage AB97/11 present bio-antimutagenic type protective activity. (C) 2003 Elsevier B.V. B.V. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Langmuir-Blodgett (LB) films from a ruthenium complex mer-[RuCl3 (dppb)(4-Mepy)] (dppb = PPh2 (CH2)(4)-PPh2; 4-Mepy = 4-methylpyridine), termed Ru-Pic, display a distinct color, which is different from the coloration exhibited by cast films or chloroform solutions. The solution and cast films are red, while the LB films are green-bluish. The manifestation of the blue color in the LB film finds its explanation in a unique absorption band at 690 nm, which is associated with the oxidation of the phosphine moieties. Fluorescence emission and absorption-reflection infrared spectroscopy measurements revealed the molecular organization in the LB films. In contrast, cast films showed a random distribution of complexes. Surface-enhanced Raman scattering was also used in an attempt to identify the main interactions in Ru-Pic.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Byrsonima intermedia is a native species of the cerrado formation (tropical American savannah). In Brazil, this plant has been used for the treatment of fever, in ulcers, as a diuretic, as antiasthinatics and in skin infections. Members of the genus Byrsonima (Malpighiaceae) are employed not only in the folk medicine but also as food to make juice, jellies and liquor. The aim of this work was to evaluate the mutagenic effects of Byrsonima intermedia, common name 'murici'. Phytochernical analysis of methanol extract furnished (+)catechin, (-)-epicatechin, quercetin-3-O-beta-D-galactopyranoside, methyl gallate, gallic acid, quercetin-3-O-alpha-L-arabinopyranoside, amentoflavone, quercetin, querceti n-3-O-(2-O-galloyl)-beta-galactopyranoside and quei-eetin-3-O-(2-O-galloyl)-alpha-arabinopyranoside. Methanol, hydromethanol and chloroform extracts were evaluated in inutagenic assay with Salmonella typhimurium (Ames test) and mice (Micronucleus test). The methanolic extract presented signs of mutagenic activity for the strains TA98 and TA100 in the Ames assay. Mutagenicity was not observed in vivo. (c) 2007 Elsevier B.V.. All rights reserved.
Resumo:
Byrsonima crassa is a plant pertaining to the Brazilian central savannah-like belt of vegetation and popularly used for the treatment of gastric dysfunctions and diarrhoea. The methanol extract contains catechin, tannins, terpenes and flavonoids; both mutagenic potential and antioxidant properties have been ascribed to flavonoids. The mutagenicity of some flavonoids is believed to be associated with the formation of reactive oxygen species and seems to depend on the number and position of hydroxyl groups. In the present study the mutagenic activity of the methanol, chloroform and 80% aqueous methanol extracts, as well as acetate and aqueous sub-fractions, of this medicinal plant were evaluated by Salmonella typhimurium assay, using strains 100, TA98, TA102 and TA97a, and in mouse reticulocytes. The results showed mutagenic activity of the methanolic extract in the TA98 strain without S9, but no mutagenicity to mouse cells in any of the extracts. The acetate fraction showed strong signs of mutagenicity without S9, suggesting that in this enriched fraction were concentrated the compounds that induced mutagenic activity. The aqueous fraction showed no mutagenic activity. The TLC and HSCCC analyses of the acetate fraction with some standard compounds permitted the isolation of the quercetin-3-O-beta-D-galactopyranoside, quercetin-3-O-alpha-L-arabinopyranoside, amentoflavone, methyl gallate and (+)-catechin, of which only the amentoflavone exhibited positive mutagenicity to TA98 (+S9, -S9). (c) 2006 Elsevier B.V.. All rights reserved.
Resumo:
An enantioselective high-performance liquid chromatographic method for the analysis of carvedilol in plasma and urine was developed and validated using (-)-menthyl chloroformate (MCF) as a derivatizing reagent. Chloroform was used for extraction, and analysis was performed by HPLC on a C18 column with a fluorescence detector. The quantitation limit was 0.25 ng/ml for S(-)-carvedilol in plasma and 0.5 ng/ml for R(+)-carvedilol in plasma and for both enantiomers in urine. The method was applied to the study of enantioselectivity in the pharmacokinetics of carvedilol administered in a multiple dose regimen (25mg/12h) to a hypertensive elderly female patient. The data obtained demonstrated highest plasma levels for the R(+)-carvedilol(AUCSS 75.64 vs 37.29ng/ml). The enantiomeric ratio R(+)/S(-) was 2.03 for plasma and 1.49 0 - 12 for urine (Aeo-12 17.4 vs 11.7 pg). Copyright (c) 2008 John Wiley & Sons, Ltd.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)