Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

The early systemic and gastrointestinal oxygenation effects of hemorrhagic shock resuscitation with hypertonic saline and hypertonic saline 6% dextran-70: A comparative study in dogs

The smaller volemic state from hypertonic (7.5%) saline (HS) solution administration in hemorrhagic shock can determine lesser systemic oxygen delivery and tissue oxygenation than conventional plasma expanders. In a model of hemorrhagic shock in dogs, we studied the systemic and gastrointestinal oxygenation effects of HS and hyperoncotic (6%) dextran-70 in combination with HS (HSD) solutions in comparison with lactated Ringer's (LR) and (6%) hydroxyethyl starch (HES) solutions. Forty-eight mongrel dogs were anesthetized, mechanically ventilated, and subjected to splenectomy. A gastric air tonometer was placed. in the stomach for intramucosal gastric CO2 (Pgco(2)) determination and for the calculation of intramucosal. pH (pHi):[pHi = pHa - log(Pgco(2)/Paco(2))].The dogs were hemorrhaged (42% of blood volume) to hold mean arterial blood pressure at 40-50 mm Hg over 30 min and were then resuscitated with LR (n = 12) in a 3:1 relation to removed blood volume; HS (n = 12), 6 mL / kg; HSD (n = 12), 6 mL / kg; and HES (mean molecular weight, 200 kDa; degree of substitution, 0.5) (n = 12) in a 1:1 relation to the removed blood volume. Hemodynamic, systemic, and gastric oxygenation variables were measured at baseline, after 30 min of hemorrhage, and 5, 60, and 120 min after intravascular fluid resuscitation. After fluid resuscitation, HS showed significantly lower arterial pH and mixed venous Po-2 and higher systemic oxygen uptake index and systemic oxygenation extraction than LR and HES (P < 0.05), whereas HSD showed significantly lower arterial pH than LR and HES (P < 0.05). Only HS and HSD did not return arterial pH and pHi to control levels (P < 0.05). In conclusion, all solutions improved systemic and gastrointestinal oxygenation after hemorrhagic shock in dogs. However, the HS solution showed the worst response in comparison to LR and HES solutions in relation to systemic oxygenation, whereas HSD showed intermediate values. HS and HSD solutions did not return regional oxygenation to control values.

Early hemodynamic and renal effects of hemorrhagic shock resuscitation with lactated Ringer's solution, hydroxyethyl starch, and hypertonic saline with or without 6% dextran-70

Background. Considering the renal effects of fluid resuscitation in hemorrhaged patients, the choice of fluid has been a source of controversy. In a model of hemorrhagic shock, we studied the early hemodynamic and renal effects of fluid resuscitation with lactated Ringer's (LR), 6% hydroxyethyl starch (HES), and 7.5% hypertonic saline (HS) with or without 6% dextran-70 (HSD).Materials and methods. Forty-eight dogs were anesthetized and submitted to splenectomy. An estimated 40% blood volume was removed to maintain mean arterial pressure (MAP) at 40 mm Hg for 30 min. The dogs were divided into four groups: LR, in a 3:1 ratio to removed blood volume; HS, 6 mL kg(-1); HSD, 6 mL kg(-1); and HES in a 1:1 ratio to removed blood volume. Hemodynamics and renal function were studied during shock and 5, 60, and 120 min after fluid replacement.Results. Shock treatment increased MAP similarly in all groups. At 5 min, cardiac filling pressures and cardiac performance indexes were higher for LR and HES but, after 120 min, there were no differences among groups. Renal blood flow and glomerular filtration rate (GFR) were higher in LR at 60 min but GFR returned to baseline values in all groups at 120 min. Diuresis was higher for LR at 5 min and for LR and HES at 60 min. There were no differences among groups in renal variables 120 min after treatment.Conclusions. Despite the immediate differences in hemodynamic responses, the low-volume resuscitation fluids, HS and HSD, are equally effective to LR and HES in restoring renal performance 120 min after hemorrhagic shock treatment. (c) 2006 Elsevier B.V. All rights reserved.

The Effects of 6% Hydroxyethyl Starch-Hypertonic Saline in Resuscitation of Dogs with Hemorrhagic Shock

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Pharmacokinetics of intraosseous and central venous drug delivery during cardiopulmonary resuscitation

We compared the pharmacokinetics of intraosseous (IO) drug delivery via tibia or sternum, with central venous (CV) drug delivery during cardiopulmonary resuscitation (CPR).Methods: CPR of anesthetized KCl arrest swine was initiated 8 min post arrest. Evans blue and indocyanine green, each were simultaneously injected as a bolus with adrenaline through IO sternal and tibial needles, respectively, n = 7. In second group (n = 6) simultaneous IO sternal and IV central venous (CV) injections were made.Results: Peak arterial blood concentrations were achieved faster for sternal IO vs. tibial IO administration (53 +/- 11 s vs. 107 +/- 27 s, p = 0.03). Tibial IO dose delivered was 65% of sternal administration (p = 0.003). Time to peak blood concentration was similar for sternal IO and CV administration (97 +/- 17 s vs. 70 +/- 12 s, respectively; p = 0.17) with total dose delivered of sternal being 86% of the dose delivered via CV (p = 0.22).Conclusions: IO drug administrations via either the sternum or tibia were effective during CPR in anesthetized swine. However, IO drug administration via the sternum was significantly faster and delivered a larger dose. (C) 2011 Elsevier B.V. All rights reserved.

Does the Choice of the Halogenated Anesthetic Influence Renal Function during Hemorrhagic Shock and Resuscitation?

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.

Comparison between RT-PCR and the mouse inoculation test for detection of rabies virus in samples kept for long periods under different conditions

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)