A SIMPLE TECHNIQUE FOR ISOLATION OF DNA SUITABLE FOR PCR AMPLIFICATION FROM CYTOGENETIC PREPARATIONS

In order to rescue molecular information from chromosome preparations, we describe a rapid procedure to obtain DNA from cytogenetic preparations in microscope slides, stored for one to live years at room temperature. This technique was modified from previously described procedures and the DNA obtained was shown to be suitable for PCR amplification.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.

Avaliação da diluição do DNA extraido de material parafinado para amplificação em PCR

Introduction: Several reasons may lead to the failure of polymerase chain reaction (PCR) using DNA purified from paraffin-embedded materials: presence of inhibitors and degradation of target DNA. DNA dilution will often reduce the concentration of potential inhibitors and still contain enough DNA to allow PCR amplification. Objective: To evaluate the dilution influence of DNA purified from paraffin-embedded materials on β-globin PCR amplification. Material and Method: Paraffin-embedded blocks from 30 patients with oropharynx squamous cell carcinomas, diagnosed and treated at the Oral Oncology Center were selected. DNA extraction was performed using QIAmp minikit (Quiagen). DNA was quantified and evaluated for purity by spectrophotometer analysis. Two groups were formed with different amounts of DNA: group I had the originally extracted DNA and group II had the same DNA, however diluted with ultrapure water addition. PCR was performed in both groups using oligonucleotides for human β-globin gene. Results: For Group I, amplification of the β-globin gene sequence was successful in 33.33% of the samples and for Group II, in 23.33%. Conclusion: Dilution of the DNA extracted of paraffin-embedded materials did not modify statistically the amount of positive samples β-globin gene amplified in PCR, although the results suggest that this is a way to increase the method for efficacy amplification of PCR.

Functional characterization by genetic complementation of aroB-Encoded dehydroquinate synthase from Mycobactetium tuberculosis H37Rv and its heterologous expression and purification

The recent recrudescence of Mycobacterium tuberculosis infection and the emergence of multidrug-resistant strains have created an urgent need for new therapeutics against tuberculosis. The enzymes of the shikimate pathway are attractive drug targets because this route is absent in mammals and, in M. tuberculosis, it is essential for pathogen viability. This pathway leads to the biosynthesis of aromatic compounds, including aromatic amino acids, and it is found in plants, fungi, bacteria, and apicomplexan parasites. The aroB-encoded enzyme dehydroquinate synthase is the second enzyme of this pathway, and it catalyzes the cyclization of 3-deoxy-D-arabino-heptulosonate-7-phosphate in 3-dehydroquinate. Here we describe the PCR amplification and cloning of the aroB gene and the overexpression and purification of its product, dehydroquinate synthase, to homogeneity. In order to probe where the recombinant dehydroquinate synthase was active, genetic complementation studies were performed. The Escherichia coli AB2847 mutant was used to demonstrate that the plasmid construction was able to repair the mutants, allowing them to grow in minimal medium devoid of aromatic compound supplementation. In addition, homogeneous recombinant M. tuberculosis dehydroquinate synthase was active in the absence of other enzymes, showing that it is homomeric. These results will support the structural studies with M. tuberculosis dehydroquinate synthase that are essential for the rational design of antimycobacterial agents.

Characterization of Escherichia coli isolated from carcasses of beef cattle during their processing at an abattoir in Brazil

Beef carcass sponge samples collected between March 2003 and August 2005 at an abattoir in Brazil were surveyed for the presence of Shiga toxin-producing Escherichia coli (STEC). Only one carcass among the 80 tested showed a STEC, stx2-encoding gene by PCR amplification. The frequency of carcass contamination by E. coli during processing was tested at three situations, respectively: preevisceration, postevisceration and postprocessing, during the rain and dry seasons. The prevalence of E. coli at the three points was of 30.0%, 70.0%, 27.5% in the rain season and of 22.5%, 55.0%, 17.5% during the dry season, respectively. The E. coli isolates exhibited a high level (45.0%) of multidrug resistance to two or more antimicrobial agents. (c) 2006 Elsevier B.V. All rights reserved.

Utilização de marcador molecular SCAR na identificação de Fusarium subglutinans, agente causal da malformação da mangueira

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Distinctively variable sequence-based nuclear DNA markers for multilocus phylogeography of the soybean- and rice-infecting fungal pathogen Rhizoctonia solani AG-1 IA

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Piezoelectric biosensors for real-time monitoring of hybridization and detection of hepatitis C virus

The piezoelectric quartz crystal resonators modified with oligonucleotide probes were used for detection of hepatitis C virus (HCV) in serum. The gold electrodes on either rough or smooth surface crystals were modified with a self-assembled monolayer of cystamine. After activation with glutaraldehyde, either avidin or streptavidin were immobilized and used for attachment of biotinylated DNA probes (four different sequences). Piezoelectric biosensors were used in a flow-through setup for direct monitoring of DNA resulting from the reverse transcriptase-linked polymerase chain reaction (RT-PCR) amplification of the original viral RNA. The samples of patients with hepatitis C were analyzed and the results were compared with the standard RT-PCR procedure (Amplicor test kit of Roche, microwell format with spectrophotometric evaluation). The piezoelectric hybridization assay was completed in 10 min and the same sensing surface was suitable for repeated use. (C) 2004 Elsevier B.V. All rights reserved.

Taenia solium DNA is present in the cerebrospinal fluid of neurocysticercosis patients and can be used for diagnosis

Neurocysticercosis is the most frequent parasitic infection of the CNS and the main cause of acquired epilepsy worldwide. Seizures are the most common symptoms of the disease, together with headache, involuntary movements, psychosis and a global mental deterioration. Absolute diagnostic criteria include the identification of cysticerci, with scolex, in the brain by MRI imaging. We demonstrate here, for the first time, that T. solium DNA is present in the cerebrospinal fluid of patients. The PCR amplification of the parasite DNA in the CSF enabled the correct identification of 29/30 cases (96.7 %). The PCR diagnosis of parasite DNA in the CSF may be a strong support for the diagnosis of neurocysticercosis.

Chromosomal painting and ZW sex chromosomes differentiation in Characidium (Characiformes, Crenuchidae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Successful carnivore identification with faecal DNA across a fragmented Amazonian landscape

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)