Comparison of conventional PCR, quantitative PCR, bacteriological culture and the Warthin Starry technique to detect Leptospira spp. in kidney and liver samples from naturally infected sheep from Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time PCR identifies a critical region of deletion on 22q13 related to prognosis in oral cancer

Quantitative real time PCR was performed on genomic DNA from 40 primary oral carcinomas and the normal adjacent tissues. The target genes ECGFB, DIA1, BIK, and PDGFB and the microsatellite markers D22S274 and D22S277, mapped on 22q13, were selected according to our previous loss of heterozygosity findings in head and neck tumors. Quantitative PCR relies on the comparison of the amount of product generated from a target gene and that generated from a disomic reference gene (GAPDH-housekeeping gene). Reactions have been performed with normal control in triplicates, using the 7700 Sequence Detection System (PE Applied Biosystems). Losses in the sequences D22S274 (22q13.31) and in the DIA1 (22q13.2-13.31) gene were detected in 10 out of 40 cases (25%) each. Statistically significant correlations were observed for patients with relative copy number loss of the marker D22S274 and stages T3-T4 of disease (P=0.025), family history of cancer (P = 0.001), and death (P = 0.021). Relative copy number loss involving the DIA1 gene was correlated to family history of cancer (P<0.001), death (P=0.002), and consumption of alcohol (P=0.026). Log-rank test revealed a significant decrease in survival (P=0.0018) for patients with DIA1 gene loss. Relative copy number losses detected in these sequences may be related to disease progression and a worse prognosis in patients with oral cancer.

Evaluation of estrogen receptor alpha and beta and progesterone receptor expression and correlation with clinicopathologic factors and proliferative marker Ki-67 in breast cancers

To elucidate the molecular profile of hormonal steroid receptor status, we analyzed ER-alpha, ER-beta, and PGR mRNA and protein expression in 80 breast carcinomas using reverse transcriptase polymerase chain reaction (RT-PCR), quantitative RT-PCR, and immunohistochemical analysis. Qualitative analysis revealed positive expression of ER-alpha, ER-beta, and PGR mRNA in 48%, 59%, and 48% of the breast carcinomas, respectively. ER-alpha, ER-beta, and PGR transcript overexpression was observed in 51%, 0%, and 12% of the cases, respectively, whereas moderate or strong protein expression was detected in 68%, 78%, and 49% of the cases, respectively. Tumor grade was negatively correlated with transcript and protein levels of ER-alpha (P = .0169 and P = .0006, respectively) and PGR (P = .0034 and P = .0005, respectively). Similarly, proliferative index Ki-67 was negatively associated with transcript and protein levels of ER-alpha (P = .0006 and P < .0001, respectively) and PGR (P = .0258 and P =. 0005, respectively). These findings suggest that ER-alpha and PGR expression are associated with well-differentiated breast tumors and less directly related to cell proliferation. A significant statistical difference was observed between lymph node status and ER-beta protein expression (P = .0208). In ER-alpha-negative tumors, we detected a correlation between ER-beta protein expression and high levels of Ki-67. These data suggest that ER-beta could be a prognostic marker in human breast cancer. (C) 2008 Elsevier B.V. All rights reserved.

Efeito da temperatura e da restrição alimentar sobre o desempenho, composição de carcaça e padrões de expressão de genes do eixo somatotrófico em frangos de corte

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

O controle epigenético da expressão gênica na carcinogênese mamária: investigação de genes candidatos a supressores tumorais mapeados em 3p21.3

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Determinação de genes/proteínas endossomais em Paracoccidioides brasiliensis e em macrófagos infectados e não infectados

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Comparative validation using quantitative real-time PCR (qPCR) and conventional PCR of bovine semen centrifuged in continuous density gradient

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Selection and validation of reference genes for gene expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp citri during infection of Citrus sinensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Identification of reference genes for expression analysis by real-time quantitative PCR in drought-stressed soybean

O objetivo deste trabalho foi validar, pela técnica de PCR quantitativo em tempo real (RT-qPCR) genes para serem utilizados como referência em estudos de expressão gênica em soja, em ensaios de estresse hídrico. Foram avaliados quatro genes comumente utilizados em soja: Gmβ-actin, GmGAPDH, GmLectin e GmRNAr18S. O RNA total foi extraído de seis amostras: três amostras de raízes em sistema de hidroponia com diferentes intensidades de déficit hídrico (0, 25, 50, 75 e 100 minutos de estresse hídrico), e três amostras de folhas de plantas cultivadas em areia com diferentes umidades do solo (15, 5 e 2,5% de umidade gravimétrica). Os dados brutos do intervalo cycle threshold (Ct) foram analisados, e a eficiência de cada iniciador foi calculada para uma analise da Ct entre as diferentes amostras. A aplicação do programa GeNorm foi utilizada para a avaliação dos melhores genes de referência, de acordo com a estabilidade. O GmGAPDH foi o gene menos estável, com o maior valor médio de estabilidade de expressão (M), e os genes mais estáveis, com menor valor de M, foram o Gmβ-actin e GmRNAr18S, tanto nas amostras de raízes como nas de folhas. Estes genes podem ser usados em RT-qPCR como gens de referência para análises de expressão gênica.

Allele frequency of hereditary equine regional dermal asthenia in American Quarter horses in Brazil determined by quantitative real-time PCR with high resolution melting analysis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Validation of absolute quantitative real-time PCR for the diagnosis of streptococcus agalactiae in fish

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Development of a real-time PCR method for rapid sexing of human preimplantation embryos

Genes on the X chromosome are known to be responsible for more than 200 hereditary diseases. After IVF, the simple selection of embryo sex before uterine transfer can prevent the occurrence of affected offspring among couples at risk for these genetic disorders. The aim of this investigation was to develop a rapid method of preimplantation genetic diagnosis (PGD) using real-time polymerase chain reaction (PCR) for the sexing of human embryos, and to compare it to the fluorescence in-situ hybridization technique, considered to be the gold standard. After biopsies were obtained from 40 surplus non-viable embryos for transfer, a total of 98 blastomeres were analysed. It was possible to analyse 24 embryos (60%) by both techniques, generating a total of 70 blastomeres (35 per technique), white 28 blastomeres from 16 embryos (40%) were analysed only by real-time PCR. A rapid and safe method was developed in the present study for the sexual diagnosis of a single human cell (blastomere and buccal cell) using the emerging technology of real-time PCR. (C) 2009, Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.