192 resultados para PCR fluorescente
em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Flavobacterium columnare is a cosmopolite bacteria and it is one of the main problem in Brazilian aquaculture, causing high mortalities index and economic damage. The main factors that contribute to columnaris disease are inadequate water quality, excess handling, high density of fish and temperature variations. For a successful epidemiological study and disease control, it is essential to differentiate the F. columnare from other yellow pigmentation bacteria. The present study used molecular techniques to characterize, by RAPD-PCR, two strains of F. columnare isolated from Oreochromis niloticus and Brycon orbignyanus. Data were analyzed as binary (0 and 1) and a genetic similarity matrix was generated by Jaccard's coefficient. Cluster analysis was performed by the neighbor joining method. The RAPD-PCR technique confirmed to be a usefull tool to obtain genetic profiles from F. columnare isolates based on the oligonucleotides used and to verify genetic similarity.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The present study was carried out to report the occurrence Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in chicken abattoirs. Samples of feces; feathers; scald, evisceration, and chiller water; and rinse water of non-eviscerated, eviscerated, and chilled carcass were collected from six chicken abattoirs. Salmonella isolates were identified by a multiplex-PCR using three sets of primers targeting the inuA, pefA, and sefA gene sequences from Salmonella spp., S. Typhimurium and S. Enteritidis, respectively. Salmonella spp. was detected in 10% (29/288) of the samples, whereas serovars Enteritidis and Typhimurium were identified in 62% (7/288), respectively. The results indicate the need to improve hygiene and sanitary standards in poultry slaughter lines, besides the education of food handlers and information to consumers. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Neste trabalho, a técnica de PCR (polymerase chain reaction) foi utilizada para a sexagem de 92 embriões bovinos fertilizados in vitro. Os embriões originaram-se de fertilização in vitro de oócitos aspirados de ovários de fêmeas bovinas, provenientes de abatedouros comerciais. Os oócitos foram maturados, fertilizados e cultivados até o estádio de blastocisto. Os embriões foram lavados em solução de PBS, transferidos para tubos de polipropileno contendo água ultrapura, e imediatamente congelados a -196ºC. Os embriões foram descongelados sobre isopor contendo gelo picado e tratados com proteinase K. Para a reação de PCR, utilizaram-se alíquotas de 34 µl de cada tudo, onde foram acrescidos dois pares de primers, seqüência BC1.2 e seqüência satélite 1.715, desoxinucleotídeos, MgCl2, tampão PCR 10X, TaqDNA polimerase e água, em um volume final de 50 µl. As amostras foram amplificadas e a eletroforese realizada em gel de poliacrilamida a 8%. Os géis foram corados com solução de brometo de etídio e analisados em transiluminador de luz ultravioleta. Um índice de 93,47% de amplificação foi atingido, com 41 embriões (47,67%) machos e 45 (52,32%) embriões fêmeas. O uso de gel de poliacrilamida a 8% foi eficaz na separação de fragmentos de DNA muito próximos.
Resumo:
A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)