175 resultados para Microemulsão. EOR. Acrilamida. Poliacrilamida

em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The serum protein concentration of newborn Holstein calves determined by means of sodium dodecyl sulphate-polyacrylamide (SDS-PAGE) was studied. Blood samples from 40 healthy newborn calves were obtained 48 hours after birth. Calves had been given 3 liters of colostrum within 2 hours after birth, following by dose corresponding by 15% of animal weight each 24 hours. The results showed three different proteinograms: 19 calves had 14 proteins with molecular weights (MW) ranging from 28,000 D to 170,000D (proteinogram 1); 11 calves had 14 proteins with MW ranging from 18,000 to 170,000 D (proteinogram 1); and 10 calves had 12 proteins with MW ranging from 28,000 D to 170,000 D (proteinogram 3). The three groups presented similar IgG levels. The highest serum concentration of ceruloplasmin were verified in proteinogram 3, which had the lowest serum level of protein with MW 58,000D. It was verified a1-antitrypsin only in proteinogram 2, which had no proteins with MW of 42,000 D and 37,000D. The highest serum concentrations of IgA and protein with MW 58,000 D, and the lowest serum levels of transferrin, haptoglobin, and acid glycoprotein were verified in proteinogram 3. Measurement of serum protein concentrations by SDS-PAGE may be useful in monitoring the occurrence of hypogammaglobulinemia and the neonatal disease in calves.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foram avaliadas amostras de soro sanguíneo de 10 cães sadios e de 12 com linfoma, utilizando-se a eletroforese em gel de poliacrilamida contendo dodecil sulfato de sódio. Houve diferença entre as médias dos teores de proteína total de cães sadios, 7,68g/dL±0,46 e de cães com linfoma, 7,93g/dL±2,49. As concentrações de IgA e IgG não foram diferentes entre os grupos. Os teores das proteínas de pesos moleculares 142000, 110000, 52000, 49000, 24000 e 18000 dáltons foram mais elevados em cães com linfoma. Os cães com linfoma apresentaram concentrações mais elevadas de ceruloplasmina, 43,95mg/dL±18,19, e haptoglobina, 554mg/dL±449,51, e menores de albumina, 2908mg/dL±476,67, em comparação aos cães sadios (ceruloplasmina: 3,42mg/dL±7,44; haptoglobina: 94,54mg/dL±59,50 e albumina: 4207mg/dL±206,18). Conclui-se que concentrações séricas mais elevadas de ceruloplasmina e haptoglobina e menores de albumina podem estar associadas ao linfoma em cães.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aiming to evaluate the puerperal influence on the proteinogram of Saanen goats, 108 samples of blood serum from 12 goats were collected, and the results were presented at nine times: just after parturition, 1, 3, 5, 7, 10, 15, 21 and 30 days after parturition. Total amount of serum proteins were determined by the biuret technique, and the sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to the protein fractionation. In this last method, 17 protein bands were observed, from which molecular weights varied between 25 KDa and 275 KDa. In addition, it was possible to identify the following protein fractions: immunoglobulin A (180 KDa), ceruloplasmin (115 KDa), transferrin (79 KDa), albumin (65 KDa), heavy-chain immunoglobulin G (58 KDa), haptoglobin (45 KDa), acid glycoprotein (37 KDa) and light-chain immunoglobulin G (28 KDa). Another 9 nonidentified protein fractions presented, each molecular weights equal to 275 KDa, 140 KDa, 125 KDa, 103 KDa, 95 KDa, 41 KDa, 35 KDa, 30 Kda and 25 KDa. The results allow us to conclude that by the first week of puerperium, an improvement of acid glycoprotein occurs, whereas those others protein fractions do not suffer any puerperal influence.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pequenas partículas de fase peroviskita de BaMnO3 foram preparadas por dois métodos: a rota da coprecipitação convencional (RCC) e o método convencional de microemulsão (MCM). As técnicas instrumentais utilizadas para caracterizar as amostras foram: microscopia eletrônica de varredura (SEM), difratometria de raios X (XRD), termogravimetria (TG) e análise térmica diferencial (DTA). A síntese de materiais em sistemas coloidais auto-organizados tem por objetivo aumentar a homogeneidade de tamanho e forma das partículas. Nos últimos anos aumentou a busca por materiais mais uniformes visando o aperfeiçoamento da microestrutura. A rota de microemulsão é um método alternativo para a síntese de materiais porque permite o controle da relação entre as concentrações de água e do tensoativo, (w), o qual controla o tamanho das gotículas de microemulsão denominadas microreatores. Peroviskita pura obtida de microemulsão forma-se em temperatura menor do que a fase precipitada, e resulta.em partículas com distribuição de tamanho mais adequada, de aproximadamente 0,1 mm de diâmetro comparado com a média de 0,5 mm das partículas coprecipitadas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Microemulsions (ME) are thermodynamically stable and isotropic systems of two immiscible liquids (oil/water), stabilized by an interfacial film of surfactants, discovered by Hoar and Schulman in 1943. The study of ME formation is based on three areas of theory: (1) solubilization, (2) interfacial tension and (3) thermodynamics. ME structures are influenced by the physicochemical properties and proportions of their ingredients. The goal of this review is to assess the state of the art of microemulsified systems, from a theoretical viewpoint. Also, recent progress on their clinical application and use as carriers for insoluble compounds is discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Ciências Farmacêuticas - FCFAR

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)