136 resultados para Lâmpada fluorescente

em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

With the imposition of the suspension of production and subsequent banning of incandescent light bulbs will be necessary to replace it by other more energy-efficient. Although the main alternative is the compact fluorescent lamp, the environmental impact caused by it due to incorrect disposal and the amount of harmonics included in the network resulting in losses related to the quality of electric power system makes them sought new alternatives for lighting systems that are efficient and have low environmental impact. In this context, the LED (Lighting Emitting Diode), based on solid-state components, is presented as an option for new projects and replacement of existing lighting. In this work we studied aspects of energy, environmental and economic impacts of a possible replacement of conventional lighting systems for new technology. From laboratory tests and surveys of the costs of different types of lamps used for residential lighting, we performed a comparative analysis considering energy and economic aspects which showed that the LED technology, but has a high initial investment, it is best when power quality and environmental preservation are relevant factors in decision making for the choice of technology to be used in the lighting system

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Odontologia - FOA

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to use a fluorescent dye and CLSM microscope to observe the effect of different light intensities on dentin tensile bond strength. Flat dentin surfaces were created on 16 intact human third molars and divided in 4 groups: Group G1 - halogen - KM -200R®; Group G2 - LED - Ultraled®; Group G3 - LED - UltraLume LED5® and Group G4 - LED - Biolux Single V®. For all the groups, the restoration procedure used Single Bond® adhesive, mixed with rodamin B and InTen-S® composite resin. Then, they were cut on serial sections to obtain 1 mm2 area and submitted to micro tensile test and after words, the fractures were analyzed with a digital microscope and CLSM. The statistical analysis showed that all in all groups, except Group G2, which had a significant smaller tensile bond strength ratio. The fracture mode analysis showed that there were significant differences when comparing groups G1 / G2, and G2 / G4. There is no evidence of relevant differences among the other groups. With these results, we conclude that the use of fluorescent dye and CLSM demonstrated to be a simple and nondestructive technique, and that there are evidences that light intensities influenced the dentine tensile.