Avaliação das condutas de biossegurança em laboratórios de prótese dentária de João Pessoa, PB, Brasil

Objective: To evaluate the biosecurity measures adopted in dental prosthesis laboratories of the city of João Pessoa, PB, Brazil with respect to prosthetic works sent by dentists. Method: Twenty-five dental prosthesis technicians (DPT) of the city of João Pessoa, PB, filled out a questionnaire referring to their knowledge of the biosecurity principles, disinfection of impressions and other prosthetic items, and the use of individual protection equipment (IPE). Results: Although 92% of the interviewees believed in the possible occurrence of cross-infection between dental prosthesis laboratories and dental offices, 64% declared that the prosthetic works received in their laboratories do not undergo any disinfection procedure. It was also observed that, for disinfection of impressions and stone casts, the chemical substances are not used as recommended by the manufacturers or are innocuous to microorganisms. Regarding the use of IPE, 60% of the DPT used mask, but only 4% used gowns. With respect to the measures taken regarding the impressions received from dental offices, 56% of the interviewees only wash them in running tap water, and 56% of the stone casts that arrive at the laboratory are not disinfected in any way. Conclusion: There is a need for more motivation and instructions to DPT regarding the prevention of cross-contamination during sending and receiving of prosthetic works between dental prosthesis laboratories and dental offices because the DPT evaluated in this study were found negligent with respect to disinfection procedures.

Planejamento em saúde bucal no município de João Pessoa, Estado da Paraíba: o cirurgiãodentista enquanto protagonista da atenção básica

The aim was to identify the perception of Oral Health Planning (OHP) of basic care (BC) dental surgeons (DSs) in João Pessoa, Paraíba State, Brazil. Seventeen BC DSs from João Pessoa were interviewed. A qualitative analysis was performed using the Discourse of the Collective Subject (DCS) methodology. DCS obtained: Impact - My work is effective when the user's need remains at the BC. Social Control - The population participates in the organization of promotional activities, but I think it doesn't have enough maturity to opine on OHP. OHP Basis and Organization - The OHP has a diverse organization and is based on user needs. It can be concluded that the knowledge of the DSs on OHP is varied. There is limited understanding about problem-solving. Social control is considered incipient and weak. It is understood that the organization of the local OHP assumes a diverse character and should be based on user demands.

Associação entre o nível de atividade física habitual e a prática de atividade física realizada na infância em escolares do ensino fundamental de João Pessoa - PB

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Sobre formação e prática de professores de matemática: estudo a partir de relatos de professores, década de 1960, João Pessoa (PB)

Pós-graduação em Educação Matemática - IGCE

A participação dos movimentos sociais urbanos na produção do espaço de João Pessoa-PB

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Análise da circulação urbana na Av. João Pessoa, cidade de Guaratinguetá e proposta de intervenção

In this work we studied the urban movement of an important avenue of the city of Guaratingueta, in the Vale do Paraíba, State of Sao Paul, which is the Avenida João Pessoa, located in the Pedregulho neighborhood. Through literature review on this topic, we could contribute to the understanding of car culture in Brazilian cities.Through research on the history of this neighborhood, and said avenue, interviews with the passers-by and also via site visits, we analyzed the situation of urban traffic of Avenida João Pessoa. One of the main intentions of the study was to propose guidelines for the improvement of urban traffic of Avenida João Pessoa

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Sociedade da Informação: avanços e retrocessos no acesso e no uso da informação

The Information Society (IS) may be taken as a geopolitical organization which started after the Third Industrial Revolution, having direct impact on the use of information and Information and Communication Technologies (ICT). The expression arose as techno-social paradigm change in the post-industrial society, aiming to use information as currency to the society-in-progress at that time. In Brazil it has become stronger with the Programa Sociedade da Informação no Brasil-Livro Verde, lunched by the Ministerio da Ciência e Tecnologia, in September 2000 without any discussion with the civil society to formulate the main document. Our main goal in this article is to discuss the Information Society in contemporary times, and also the organized and conscious use of information, looking for key-concepts to a better understanding of it, from some topics as digital inclusion-exclusion to the use of digital informational resources.

Uma proposta de framework como infra-estrutura de implementação de sistemas informacionais baseados na visão dos FRBR orientado a objetos

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

O modelo de dados Resource Description Framework (RDF) e o seu papel na descrição de recursos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Redes sociais e comunidades virtuais para a preservação e transmissão das tradições gaúchas na Internet

Considerando a potencialidade apresentada pelas tecnologias de informação e comunicação na atualidade este estudo aponta as formas pelas quais grupos sociais mobilizados em torno de uma vinculação étnica podem se servir do aparato da Internet, em especial do World Wide Web, para divulgar aspectos de sua cultura e modo de vida. Trata-se de grupos dedicados ao ensino, transmissão, preservação e disseminação da tradição gaúcha vinculados aos Centros de Tradições Gaúchas (CTG). Especificamente, este artigo apresenta como os tradicionalistas gaúchos estabelecem suas redes sociais na Internet, constituindo comunidades virtuais em torno do tema cultura e tradição gaúcha, fazendo uso dos serviços da Web 2.0. Abordam-se neste estudo experiências que indicam que o terreno virtual é fértil e possível de transformar e revolucionar o campo das tradições, sua preservação, disseminação e (re)invenção. No contexto de modernidade tardia esse recurso não pode ser descartado. Independente da análise se situar no campo econômico, político ou cultural, entre tantos outros, o fato é que a Internet se constitui num meio eficaz e abrangente de transmitir, ensinar e preservar conteúdos de todos os tipos.

Direito autoral e tecnologias de informação e comunicação no contexto da produção, uso e disseminação de informação: um olhar para as Licenças Creative Commons

The development of information and communication technologies, in particular, Internet, and its Web 2.0 information environment has led to significant changes in contemporary society as to the ways of producing informational content. Collaboration and remix, favored by the new services and applications resulting from the development of the Web, are practices which contribute for the exponential growth of information producers. An important part of humanity ceases to be a mere consumer of symbolic goods and becomes a member in a society that sees in the collaboration and remix a new form of creation, use and dissemination of intellectual content. However, as such practices involve the production and use of information intelectual content, and are ruled by a legisltion which determine determines under what conditions the author and the user must produce and use the intellectual work. This legislation established for a context prior to the develompment of the Web has created an imbalance in the context of Web 2.0 which needs to be solved in some way so as to provide the required rebalance for the flow of information. This study explores the collaborative Web environment, the scope of copyright law in Web enviroment and the Creative Commons licenses as an alternative for producers and users of information to create, recreate, share, use, reuse and disseminate legally the intellectual production for the benefit of the construction of knowledge.

Arquitetura da informação no ambiente digital: avaliando as relações com o direito da propriedade intelectual

Investigates the relationship between Information Architecture in digital environments with Intellectual Property Rights. The work is justified by the need to better understand the emerging dynamics of Digital Information and Communication Law Technologies and Intellectual Property Rights. Three areas of knowledge are directly related to the study: Information Science, Law and Computer Science. The methodology used in the investigative process is aligned with the qualitative approach. With respect to the technical procedures the research is classified as bibliographic or secondary sources. The results showed that the current Brazilian legislation does not provide the adequate mechanisms necessary to protect the intellectual property rights associated to an Information Architecture project to its holders.

Organização temática da doutrina jurídica: elementos metodológicos para uma proposta de extensão da classificação decimal de direito

Specificity and updating of the bibliographic classification systems can be considered a determinant factor to the quality of organization and representation of the legal documentation. In the specific case of Brazil, the Brazilian Law Decimal Classification, does not foresee specific subdivisions for Labor Law procedures. In this sense, it carries out a terminological work based on table of contents of doctrinal Labor Law books of the mentioned area, which are compared to the conceptual structure of the Brazilian Law Decimal Classification. As a result, it presents an extension proposal for Labor Procedures as well as a methodological background for further extensions and updates.