Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Fruit and seed ontogeny related to the seed behaviour of two tropical species of Caesalpinia (Leguminosae)

Caesalpinia echinata and C ferrea var. ferrea have different seed behaviours and seed and fruit types. Comparison of the seed ontogeny and anatomy partly explained the differences in seed behaviour between these two species of Brazilian legumes; some differences were also related to fruit development. The seed coat in C. ferrea consisted of two layers of osteosclereids, as well as macrosclereids and fibres, to form a typical legume seed coat, whereas C. echinata had only macrosclereids and fibres. In C. echinata, the developing seed coat had paracytic stomata, a feature rarely found in legume seeds. These seed coat features may account for the low longevity of C. echinata seeds. The embryogeny was similar in both species, with no differences in the relationship between embryo growth and seed growth. The seeds of both species behaved as typical endospermic seeds, despite their different morphological classification (exendospermic orthodox seeds were described for C. echinata and endospermic orthodox seeds for C. ferrea). Embryo growth in C. ferrea accelerated when the sclerenchyma of the pericarp was developing, whereas embryonic growth in C. echinata was associated with the conclusion of spine and secretory reservoir development in the pericarp. Other features observed included an endothelial layer that secreted mucilage in both species, a nucellar summit, which grew up into the micropyle, and a placental obturator that connected the ovarian tissue to the ovule in C. ferrea. (C) 2004 the Linnean Society of London.

Mastigação simulada e digestão ácido-enzimática de sementes de leguminosas forrageiras tropicais

This study aimed to evaluate the effect of simulated chewing in the laboratory on the survival of seeds of four tropical forage legumes (butterfly pea, Clitorea ternatea; estilosantes, Stylosanthes capitata/S. macrocephala 'Campo Grande; archer, Macrotyloma axillare and perennial soybean, Neonotonia wightii) submitted to different periods of acid enzymatic digestion in vitro. Three trials were conducted to observe the percentage of destroyed seeds by the mastication; to compare the germination of the seeds (intact seeds, simulated mastication, scarification with sandpaper, mastication and scarification with sandpaper). And, finally the seeds were incubated at 39oC with hydrochloric acid and pepsin for: 0, 2, 4, 8, 12 and 24 hours. The percentages of not destroyed seeds in mastication (archer, 91,5; perennial soybean, 88.0; butterfly pea, 82.1, and estilo, 81.1), associated with the beneficial effects of scarification on germination (64.7, 60.0, 92.0 e 87.3%, respectively) and the effects of time of acid-enzymatic digestion (75% higher if they stay 24 hours in HCl + pepsin) associated to the hard and not permeable coats of legume seeds, allow a high potential for resistance, and to pass intact through the digestive tract of cattle, being able to germinate when defecated in the pastures. However, estilo should not be included in the feeding of cattle for this purpose, because it do not resists the acid-enzyme digestion.

Efeito do consumo de tremoço (Lupinus albus) e seu isolado protéico no metabolismo do colesterol em hamsters hipercolesterolemizados

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Expression studies in the embryo and in the micropylar endosperm of germinating coffee (Coffea arabica cv. Rubi) seeds

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

The development of seedlings from fragments of monoembryonic seeds as an important survival strategy for Eugenia (Myrtaceae) tree species

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Effect of tegument integrity on the light sensitivity in seeds of Cucumis anguria L

Cucumis anguria present dark germinating seeds at 25 degrees C. Seeds without the tegument are photosensitive germinating better in darkness than under continuous white light. However, pre-incubation at 40 degrees C for 48 hours allows the seeds to germinate under continuous white light and the incubation of naked seeds at -0.6MPa restored the light inhibition of seed germination. Our results suggest that the tegument interact with the phytochrome in the control of seed germination in part of the population of seed of C. anguria.

Structure of a lectin from Canavalia gladiata seeds: new structural insights for old molecules

Background: Lectins are mainly described as simple carbohydrate- binding proteins. Previous studies have tried to identify other binding sites, which possible recognize plant hormones, secondary metabolites, and isolated amino acid residues. We report the crystal structure of a lectin isolated from Canavalia gladiata seeds ( CGL), describing a new binding pocket, which may be related to pathogen resistance activity in ConA- like lectins; a site where a non- protein amino- acid, aaminobutyric acid ( Abu), is bound.Results: the overall structure of native CGL and complexed with alpha- methyl- mannoside and Abu have been refined at 2.3 angstrom and 2.31 angstrom resolution, respectively. Analysis of the electron density maps of the CGL structure shows clearly the presence of Abu, which was confirmed by mass spectrometry.Conclusion: the presence of Abu in a plant lectin structure strongly indicates the ability of lectins on carrying secondary metabolites. Comparison of the amino acids composing the site with other legume lectins revealed that this site is conserved, providing an evidence of the biological relevance of this site. This new action of lectins strengthens their role in defense mechanisms in plants.

Native crystal structure of a nitric oxide-releasing lectin from the seeds of Canavalia maritima

Here, we report the crystallographic study of a lectin from Canavalia maritima seeds (ConM) and its relaxant activity on vascular smooth muscle, to provide new insights into the understanding of structure/function relationships of this class of proteins. ConM was crystallized and its structure determined by standard molecular replacement techniques. The amino acid residues, previously suggested incorrectly by manual sequencing, have now been determined as I17, I53, S129, S134, G144, S164, P165, S187, V190, S169, T196, and S202. Analysis of the structure indicated a dimer in the asymmetric unit, two metal binding sites per monomer, and loops involved in the molecular oligomerization. These confer 98% similarity between ConM and other previously described lectins, derived from Canavalia ensiformis and Canavalia brasiliensis. Our functional data indicate that ConM exerts a concentration-dependent relaxant action on isolated aortic rings that probably occurs via an interaction with a specific lectin-binding site on the endothelium, resulting in a release of nitric oxide. (C) 2005 Elsevier B.V. All rights reserved.

Changes in protein fractions, trypsin inhibitor and proteolytic activity in the cotyledons of germinating chickpea

The chickpea seed germination was carried out in 6 days. During the period it was observed a little variation on total nitrogen contents, however the non protein nitrogen was double. A decrease of 19.1 and 20.6% in relation to total nitrogen was observed to the total globulin and albumin fractions, respectively. The gel filtration chromatography on Sepharose CL-6B and SDS-PAGE demonstrated alterations on the distribution patterns of the albumin and total globulin fractions between the initial and the sixth day of germination suggesting the occurrence of protein degradation in the germination process.The assay for acid protease only appeared in the albumin fraction with casein and chickpea total globulin as substrates, whereas the former was more degradated than the latter, however the transformations detected in the protein fractions apppear indicated that others enzymes could be acting during the process. The trypsin inhibitor activity had a little drop after six day of germination indicating a possible increase on the digestibility of the proteins.

cDNA cloning and 1.75 Å crystal structure determination of PPL2, an endochitinase and N-acetylglucosamine-binding hemagglutinin from Parkia platycephala seeds

Parkia platycephala lectin 2 was purified from Parkia platycephala (Leguminosae, Mimosoideae) seeds by affinity chromatography and RP-HPLC. Equilibrium sedimentation and MS showed that Parkia platycephala lectin 2 is a nonglycosylated monomeric protein of molecular mass 29 407 ± 15 Da, which contains six cysteine residues engaged in the formation of three intramolecular disulfide bonds. Parkia platycephala lectin 2 agglutinated rabbit erythrocytes, and this activity was specifically inhibited by N-acetylglucosamine. In addition, Parkia platycephala lectin 2 hydrolyzed β(1-4) glycosidic bonds linking 2-acetoamido-2-deoxy-β-d-glucopyranose units in chitin. The full-length amino acid sequence of Parkia platycephala lectin 2, determined by N-terminal sequencing and cDNA cloning, and its three-dimensional structure, established by X-ray crystallography at 1.75 Å resolution, showed that Parkia platycephala lectin 2 is homologous to endochitinases of the glycosyl hydrolase family 18, which share the (βα) 8 barrel topology harboring the catalytic residues Asp125, Glu127, and Tyr182. © 2006 The Authors.

Allelopathic effects of aqueous extract of Brassica napus on germination of seeds of Phaseolus vulgaris

Secondary compounds produced by plants are considered an alternative method of weed suppression but can cause negative effects on crops in succession, especially in a no-tillage system, due to the degradation of crop residues with allelopathic potential. The objective of this work was to analyze the influence of foliar aqueous extracts of Brassica napus on the germination and initial development of seedlings of Phaseolus vulgaris. The extract was prepared as a stock 10 % weight/volume solution, and diluted into treatments of relative concentrations of 100 % (i.e. 10 % w/v stock), 75 %, 50 %, 25 % and 0 % (untreated control consisting of distilled water), in a completely randomized design. The seeds of Phaseolus vulgaris were moistened with the differing concentrated extracts and kept in a germination chamber at 25 °C, with a photoperiod of 12 h for nine days. The variables evaluated were: percentage germinating, first count of germination and germination velocity index, as well the root and hypocotyl length, and fresh and dry mass of the seedlings. The aqueous leaf extracts of Brassica napus did not influence the germination of Phaseolus vulgaris seeds, but did induce the growth of abnormal seedlings by inhibition of secondary roots and reduced prominence of the primary root.

Aspectos morfológicos de frutos e sementes e caracterização citogenética de Crotalaria lanceolata E. Mey. (Papilionoideae - Fabaceae)

Frutos, sementes e plântulas de Crotalaria lanceolata, conhecida popularmente como guizo-de-cascavel, chocalho-de-cobra, xique-xique ou feijão-de-guizo, planta tóxica infestante que ocorre no Estado de São Paulo, foram estudadas morfologicamente e citogeneticamente. Os frutos são secos, deiscentes, polispérmicos e do tipo legume. As sementes são reniformes e o embrião é constituído de eixo embrionário e dois cotilédones. A testa pode apresentar variadas tonalidades de castanhos. A germinação é epígea e fanerocotiledonar. A espécie apresenta número cromossômico diplóide 2n = 16 com formulação cariotípica 12M + 4SM e comprimento cromossômico médio geral de 3,340 ± 0,689.

Produção e qualidade fisiológica de sementes de soja avaliadas na semeadura de inverno

O cultivo da soja fora da época convencional pode ser uma alternativa de rotação de cultura além de proporcionar sementes de melhor qualidade fisiológica, que podem ser utilizadas na semeadura da próxima safra diminuindo o período de armazenamento. O trabalho de pesquisa teve por objetivo avaliar o comportamento de sete cultivares de soja, em três densidades populacionais, quanto ao porte e altura de inserção da primeira vagem, assim como quanto à produção e qualidade fisiológica das sementes, semeadas no período de inverno, na região de Selvíria-MS. O delineamento experimental foi em blocos casualizados, com quatro repetições, dispostos em esquema fatorial 7 ×3. Os tratamentos constaram de sete cultivares (IAC-16, IAC-Foscarin 31, FT-2, IAC-17, IAC-8, Doko e FT-Cristalina) e três densidades de plantas (300, 400 e 500 mil plantas ha-1). O ciclo da soja foi reduzido no cultivo de inverno, principalmente nos cultivares considerados tardios. O fotoperíodo no cultivo de inverno reduziu o período entre o florescimento e a maturação. O cultivar IAC-8 foi o menos sensível ao fotoperíodo, possuindo maturação em época semelhante aos cultivares tardios, e apresentou as melhores características agronômicas para o cultivo no período de inverno. É aconselhável o aumento de densidade de semeadura quando do uso de cultivares precoces em cultivos de inverno. Não é aconselhável armazenar sementes em condições ambientes, principalmente com valores de germinação próximo ao limite inferior desejável (80%).