10 resultados para Elda
em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"
Resumo:
Este trabalho foi realizado para verificar se a ultra-sonografia do pâncreas oferece dados auxiliares na classificação de diabéticos adultos dos tipos 1 e 2. O tamanho e a ecogenicidade do pâncreas foram determinados pela ultra-sonografia em 81 diabéticos, sendo 20 do tipo 1 e 61 do tipo 2 (53 obesos e oito não-obesos). Os pacientes tipo 2 obesos diferiram dos demais por apresentarem área total e diâmetro ântero-posterior do corpo do pâncreas significativamente maiores. Quanto à ecogenicidade pancreática, esta estava aumentada com maior freqüência nos diabéticos tipo 2 obesos que nos diabéticos tipo 1. Consideramos, assim, que a ultra-sonografia do pâncreas constitui metodologia auxiliar na classificação de diabéticos entre os tipo 1 e 2, sendo menos eficaz quando os últimos não são obesos.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Measures employed to control visceral leishmaniasis in Brazil have focused on vector control by residual insecticide spraying and diagnosis of infection with elimination of positive dogs. We describe dog culling and replacement in a Brazilian endemic area (the Alvorada District, Aracatuba, SP) in order to better understand dog population dynamics when elimination of the dog reservoir is adopted as the main control measure. From August 2002 to July 2004, 60.9% of the estimated dog population for the area was culled with a mean age of 34 months old. The presence of anti-Leishmania sp. antibodies was recorded for only 26.7% of the euthanized canines. Replacement was observed in 38.8% of the cases, some of them by 2 or more dogs and in a mean time of 4 months. Dogs were replaced mostly by puppies of both sexes with a mean age of 6.8 months. From August 2002 to April 2005 we were able to follow-up 116 of these dogs, during a mean time of 8.7 months. Canine visceral leishmaniasis seropositivity by ELISA was observed in 42.2% of the followed dogs, 30.6% of which were already positive at the first evaluation. By the end of the follow-up period 37% of the dogs were submitted to euthanasia, with a mean age of 18.3 months. In the studied CVL endemic area of Brazil, euthanasia and the subsequent replacement ratio were high, increasing the dog population turnover and leading to a younger population that might be more susceptible to a variety of other infectious diseases in addition to CVL. Dog culling as a control strategy for VL should be reassessed. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Enfermagem (mestrado profissional) - FMB
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.